Phusion Site-Directed Mutagenesis Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Phusion Hot Start II DNA Polymerase tends to work better at elevated denaturation and annealing temperatures due to higher salt concentrations in its buffer. Hence follow manufacturer instruction strictly.

Upstream tips
Phusion Hot Start II DNA Polymerase tends to work better at elevated denaturation and annealing temperatures due to higher salt concentrations in its buffer. Hence follow manufacturer instruction strictly.

Publication protocol

HCV RNA replication monitored by FACS.
A subgenomic Con1-NS5A-YFP replicon plasmid was established by insertion of the yellow fluorescent protein (YFP) into the C terminus of the NS5A gene (MVSKGEELF-YFP-TLGMDELYK) as described previously (27, 36) via homologous recombination using the In-Fusion HD cloning kit (Clontech). A Huh7.5.1 Con1-NS5A-YFP stable cell line was achieved by electroporation of Con1-NS5A-YFP RNA into Huh7.5.1 cells. In brief, RNA was synthesized from SpeI-linearized Con1-NS5A-YFP DNA using the T7 Megascript kit (Ambion), and Huh7.5.1 cells (4 × 106) were electroporated with viral RNA (10 μg) and selected with G418 (50 μg/ml) for 3 weeks. Huh7.5.1 Con1-NS5A-YFP replicon cells were enriched using a BD FACSAria sorter. For drug inhibition, compounds were added to Huh7.5.1 Con1-NS5A-YFP replicon cells (500,000) 24 h postseeding. Replicon replication was analyzed via fluorescence-activated cell sorting (FACS) 1, 2, 3, and 4 days after drug treatment. At the time of YFP expression analysis, cells were trypsinized, washed twice with PBS, and resuspended in 500 μl of sorting buffer (PBS supplemented with 1 mM EDTA, 25 mM HEPES, pH 7.0, and 1% fetal bovine serum [FBS]). FACS analysis was performed using a BD LSR II flow cytometer system and FACSDiva software. Gates for the fluorescein isothiocyanate A (FITC-A) and Pacific Blue channels were set using empty Huh7.5.1 cells as negative controls, and YFP expression was measured within the FITC-A-positive gate. Results (triplicates) were all normalized to dimethylsulfoxide (DMSO) controls. Con1-NS5A-D320E/Y321N-YFP mutant replicons were generated via site-directed mutagenesis utilizing the Phusion site-directed mutagenesis kit (NEB). D320E/Y321N mutant replicons were generated from the wild-type Con1-NS5A-YFP replicon. Con1-NS5A-D320E-YFP, Con1-NS5A-Y321N-YFP, and Con1-NS5A-D320E/Y321N-YFP were generated using the following forward and reverse phosphorylated (p) primer sets, respectively: (p)GGGCACGCCCGGAATACAACCCTCCACTGT and (p)ATATGGGCATCGCTCGAGGGAATTTCCTGG, (p)GATAACAACCCTCCACTGTTAGAGTCCTGGAAGGA and (p)CGGGCGTGCCCATATGGGCATCGCTCGAGGGAATT, and (p)GAGAACAACCCTCCACTGTTAGAGTCCTGGAAGGA and (p)CGGGCGTGCCCATATGGGCATCGCTCGAGGGAATT. PCR products were circularized with Quick T4 DNA ligase (NEB) for 5 min and transformed into NEB 10-beta competent cells. The NS5A gene of all established cell lines was sequenced to eliminate the possibility of mutation emergence during stable cell line selection.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation Huh7 NS5A using Phusion Site-Directed Mutagenesis Kit from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for Phusion Site-Directed Mutagenesis Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation Huh7 NS5A using Phusion Site-Directed Mutagenesis Kit from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.