Phusion Site-Directed Mutagenesis Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Phusion Hot Start II DNA Polymerase tends to work better at elevated denaturation and annealing temperatures due to higher salt concentrations in its buffer. Hence follow manufacturer instruction strictly.

Upstream tips
Phusion Hot Start II DNA Polymerase tends to work better at elevated denaturation and annealing temperatures due to higher salt concentrations in its buffer. Hence follow manufacturer instruction strictly.

Publication protocol

Generation of DMD 5’ and 3’ UTR reporter constructs and mutagenesis
The full-length DMD 3’ UTR was amplified from a European human genomic DNA sample using PCR and the following specific primers GCCGCTTCCTAGGAGGAAGTCTTTTCCACATGGC and GCTCATGGGATCCGCATGTATTACCTATTTAAAAAGTAAGTAAGTAAG that include an overhang containing the sequence of AvrII and BamH1 restriction sites, respectively. The resulting 2,811 bp PCR product was digested with XbaI and AvrII and ligated into the XbaI and BamHI restriction sites of pHRL-CMV (Promega) immediately downstream of the Renilla Luciferase ORF. The resulting plasmid contains the human DMD 3’ UTR in place of the SV40 polyA region of the pHRL-CMV vector. The DMD 3’ UTR was inserted in the reverse orientation as described above except that the 3’ UTR from genomic DNA was amplified using a forward primer containing the BamH1 restriction site and the reverse primer containing the AvrII restriction site.

The dp427m, dp427c, and dp427p1 5’ UTRs and surrounding regions were amplified from a human European genomic DNA sample using PCR and primers specific to each region (Supplementary Table 1). The resulting PCR products were used as a template for a second PCR that amplified the dp427m, dp427c, and dp427p1 5 ‘UTRs using primers specific to each 5’ UTR and containing overhang sequences with the KpnI and XhoI cut sites in the forward and reverse primers, respectively (Supplementary Table 1). The pHRL-CMV vector containing the DMD 3’ UTR (3’ UTR construct) was amplified using primers that annealed at the beginning of the Renilla coding sequence containing an overhang with the KpnI cut site in the reverse primer, and an XhoI cut site and the dp427m, dp427c, or dp427p exon 1 in the forward primer (Supplementary Table 1). The amplified 5’ UTR products were digested with KpnI and XhoI and ligated into the amplified 3’ UTR vectors containing the exon 1 isoforms. The resulting XhoI cut site found between the DMD 5’ UTRs and the coding sequence was removed using the Phusion Site-Directed Mutagenesis Kit (Thermo Scientific), as specified by the manufacturer using phosphorylated primers specific for each construct (Supplementary Table 1).

Deletion constructs were made using the Phusion Site-Directed Mutagenesis Kit (Thermo Scientific), as specified by the manufacturer using the DMD 3’ UTR construct as a template and phosphorylated primers specific for each deletion (Supplementary Table 2). For all subsequent experiments, plasmid DNA was prepared using QIAGEN kits.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Mouse - Deletion C2C12 DMD using Phusion Site-Directed Mutagenesis Kit from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for Phusion Site-Directed Mutagenesis Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Mouse - Deletion C2C12 DMD using Phusion Site-Directed Mutagenesis Kit from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.