pSpCas9 (PX165)

CRISPR Mouse - Deletion αT3 IP3R1

Experiment
CRISPR Mouse - Deletion αT3 IP3R1
Product
pSpCas9 (PX165) from Addgene
Manufacturer
Addgene

Protocol tips

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Generation and Analysis of IP3R1 Knock-out (KO) Lines
The CRISPR/hCas9 system (27) was used to target exons within the mouse IP3R1 gene and create αT3IP3R1KO cell lines as described (25). Oligonucleotides targeting exons 5 or 13 (GGTGCGGAGTATCGATTCAT and GCACCTCCACGCAGAGTCGT, respectively) were introduced into αT3 cells and clones were screened by immunoblotting with anti-IP3R1 (25). Of the cell lines screened, ∼25% lacked IP3R1, and 2 lines for each targeted exon were characterized further with essentially identical results. Cells (106/9.6 cm2 well) were transiently transfected with IP3R1HA constructs (0.25–1.2 μg of cDNAs and 6 μl of 1 mg/ml PEI) and were harvested 48 h later.

Full paper   Login or join for free to view the full paper.

Reviews

pSpCas9 (PX165) from Addgene has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

2 years ago

Author: Mario Udinese Italy

Floxing mice with CRISPR

Hi everyone! I am planning on floxing mice with CRISPR but I am having trouble deciding which region to target. Do you have any tips on choosing?

Discussion

2 years ago

Author: Ben Saar Israel

How to choose a region to target for CRISPR

Hi everyone! I am planning on floxing mice with CRISPR but I am having trouble deciding which region to target. Do you have any tips on choosing?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion αT3 IP3R1 using pSpCas9 (PX165) from Addgene.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Addgene for pSpCas9 (PX165) below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion αT3 IP3R1 using pSpCas9 (PX165) from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Become shareholder Discussions About us Contact Privacy Terms