TransIT-TKO Transfection Reagent

siRNA / RNAi /miRNA transfection Human - Primary splenocytes Polymer / lipid

Experiment
siRNA / RNAi /miRNA transfection Human - Primary splenocytes Polymer / lipid
Product
TransIT-TKO Transfection Reagent from Mirus
Manufacturer
Mirus

Protocol tips

Protocol tips
siRNA concentration-50–100 nM final concentration

Mix siRNA:reagent mixture and incubate at room temperature for 15–30 minutes.

Add mixture to cells and incubate for 24hours.

Publication protocol

siAPC-C (gacgttgcgagaagttgga), siAPC729 (gaggtcatctcagaacaag), siAPCL413 (ggtgtttcctgctgaatga), siAPCL5100 (ggcgccaattcaattgtca), siHIF1α [46], siHIF2α [46] or siGFP (aagctacctgttccatggcca) (50–100 nM final concentration) were transfected into cells overnight using 1 µl Transit TKO (MoBiTec, Göttingen, Germany) per µl siRNA (20 µM). The sequences show only the coding strand.

Full paper   Login or join for free to view the full paper.

Reviews

TransIT-TKO Transfection Reagent from Mirus has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

1 year ago

Author: Keith L. Morrison Canada

siRNA/RNAi/miRNA transfection human

I would like to regulate the expression of a gene and in order to do that, I have purchased specific siRNA. After optimizing my transfection protocol and using electroporation I have achieved a 60-70% reduction of the gene of interest. However, I cannot observe a significant reduction of mRNA expression but only a reduction of protein. What might be the problem? Could the problem be in my cell treatment method?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / RNAi /miRNA transfection Human - Primary splenocytes Polymer / lipid using TransIT-TKO Transfection Reagent from Mirus.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Mirus for TransIT-TKO Transfection Reagent below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / RNAi /miRNA transfection Human - Primary splenocytes Polymer / lipid using TransIT-TKO Transfection Reagent from Mirus. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Become shareholder Discussions About us Contact Privacy Terms