pSpCas9(BB)-2A-Puro (PX459)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Generation of the Etv2 Promoter Mutant (Mut) ES Cells
The 3.9-kb upstream promoter was deleted in V6.5 ES cells using the CRISPR/Cas9 system following protocols described previously (45). The 5′ (AATGCAAGCTTACCCCCAGC) and 3′ (GCCAGAGGTGAGCCACGAAC) guide RNAs (gRNAs) were cloned into the mammalian codon-optimized Cas9 expressing plasmid pX459 (Addgene, plasmid 48139). V6.5 ES cells were transfected with two plasmids expressing the 5′ and 3′ gRNAs targeting the 5′ and 3′ ends of the Etv2 3.9-kb upstream promoter. 24 h after transfection, cells were treated with 2 μg/ml puromycin for 48 h. The cells were then seeded at a clonal density on mouse embryonic fibroblast feeder cells. Individual colonies were selected after 7 days, expanded, and genotyped by PCR (the WT would yield a 4501-bp product, whereas a biallelic deletion of the promoter would yield an ∼454-bp product). The PCR products were cloned into the pCR2.1 TOPO plasmid, and the deletion was verified by sequencing. The clone verified for homozygous deletion of the promoter (Mut) was characterized further by EB differentiation,qRT-PCR, and FACS.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion ES (embryonic stem) cells Etv2 promoter using pSpCas9(BB)-2A-Puro (PX459) from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for pSpCas9(BB)-2A-Puro (PX459) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion ES (embryonic stem) cells Etv2 promoter using pSpCas9(BB)-2A-Puro (PX459) from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.