CpGenome Universal DNA Modification Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	For best results, the CT Conversion Reagent should be prepared freshly and used immediately following preparation.

Protocol tips
For best results, the CT Conversion Reagent should be prepared freshly and used immediately following preparation.

Publication protocol

Bisulfite sequencing.
For mapping of methylated cytosine residues (14), DNAs were modified by a CpGenomeTm DNA modification kit (Intergen Inc.) and the reaction products were amplified with primers specific for modified HPV-16 DNA. Msp3F (genomic positions 4322 to 4348; ATTTGATATTATATTTAAGGTTGAA) and msp3R (4970 to 4946; AATAATTACAAAAACAAAATCTACA) spanned part of the L2 gene. Msp4F (7498 to 7522; TAGTTTTATGTTAGTAATTATGGTT) and msp4R (161 to 140; ACAACTCTATACATAACTATAATA) amplified a segment with the enhancer-promoter. The amplification products were directly sequenced with the same primers.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing DNA methylation profiling Gene specific profiling - SiHa L2 using CpGenome Universal DNA Modification Kit from Millipore.

Manufacturer protocol

Download the product protocol from Millipore for CpGenome Universal DNA Modification Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing DNA methylation profiling Gene specific profiling - SiHa L2 using CpGenome Universal DNA Modification Kit from Millipore. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.