TopTaq Master Mix Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Amplicon size should be consistent for each target sequence and limited to approximately 65 - 100 bp.

Upstream tips
Amplicon size should be consistent for each target sequence and limited to approximately 65 - 100 bp.

Publication protocol

Serum and urine samples - Paired biological samples from urine and serum were collected between 08:00 am-11:00 am at the NCLF outpatient clinic from July-December 2009. To each 50 mL urine sample, 50 µL of 10 mM ethylenediaminetetra-acetic acid was added. The biological samples were stored in the NCLF biological samples bank at -80ºC (Rocha et al. 2009).

Investigation of circulating W. bancrofti antigen (CWBa) - The investigation of CWBa was carried out with monoclonal AD12 (ICT card test) and Og4C3 (ELISA) in accordance with Weil et al. (1997) and TropBIO (1996), respectively. The rapid AD12-Card ICT test (NOW® Filariasis) is considered positive when any degree of colouring (light or dark) appears in the result position of the test. Additionally, it is considered positive or negative only when the control line can be visualised. For the Og4C3-ELISA in accordance with TropBIO (1996), samples with ag/mL > 128 units were considered positive. The serum sample pairs for CWBa were collected in accordance with Rocha et al. (2004).

Investigation of adult worms - Ultrasound (US) with a 7.5 MHz probe was used to visualise the presence of live adult W. bancrofti worms in lymphatic vessels, which is commonly known as the “filarial dance sign” (FDS) (Amaral et al. 1994, Norões et al. 1996).

Extraction and purification of DNA - To optimise the PCR systems, adult W. bancrofti worms from the bank of NCLF were extracted by using the illustraTM tissue & cells genomicPrep Mini Spin Kit (GE Healthcare, UK) in accordance with the manufacturer’s instructions. A specificity study of the technique was conducted using the DNA of species that coexist in areas where W. bancrofti is considered endemic. Thus, the DNA was quantified in a spectrophotometer and the samples stored at -20º.

DNA was extracted from serum by using the illustraTM blood genomicPrep Mini Spin Kit (GE Healthcare) and from urine using phenol chloroform as described by Sambrook et al. (1989) with some modifications. The samples were stored at -20º.

PCR-based systems for detection of W. bancrofti DNA - The primers used were WbR (anti-sense; 5’TTGTTCCTCTATTTGAGACC3’), WbF (sense; 5’CACCGGTATCGAGATTAATT3’) and Wb2 (anti-sense; 5’TGGATGTATGTCAAAAAGCA3’), the target of which is a tandem-specific region for W. bancrofti (Kanjanavas et al. 2005) and a multiple alignment of primers can be seen in Fig. 1.



An external file that holds a picture, illustration, etc. Object name is 0074-0276-mioc-109-8-0978-gf01.jpg



Fig. 1

: multiple alignments of the primers WbR (Wb), WbF and Wb2.



The internal (WbF/Wb2) and external PCRs (WbR/WbF) were carried out using the Top-TaqTM Master Mix Kit (QIAGEN, Germany) with the addition of 1.5 mM magnesium, the primers and ultrapure autoclaved water to a final volume of 25 µL. For the external PCR (WbR/WbF) 5 µM of the primers (WbR/WbF) was used and cycling was carried out in a thermocycler (Bioer LifePro, China) with initial denaturation at 90ºC for 3 min, followed by 30 cycles of denaturation at 90ºC for 1 min, annealing at 55ºC for 1 min and extension at 72ºC for 1 min and a final extension at 72ºC for 8 min, amplifying a fragment of 780 bp. For the internal PCR (WbF/Wb2) 25 µM of primers (WbF/WbR) was used and cycling began with initial denaturation at 90ºC for 3 min, followed by 25 cycles of denaturation at 90ºC for 45 s, annealing at 60ºC for 45 s and extension at 72ºC for 45 s, with a final extension at 72ºC for 5 min, amplifying a fragment of 400 bp.

Semi-nested PCR simple PCRs as described and optimised before with an aliquot of 2 µL of external PCR (WbR/WbF) product working as a template for the internal PCR (WbF/Wb2), which had a final volume of 25 µL.

Finally, 10 µL of each PCR product was analysed using electrophoresis in a 2% agarose gel with Blue Green Colouring (LGC, Brazil). The DNA bands were separated electrophoretically and the results were visualised with an ultraviolet light transilluminator and photographed using a Polaroid MP4+ SystemTM documentation system (Sigma, USA).


Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing PCR Conventional / Qualitative PCR - mammalian DNA using TopTaq Master Mix Kit from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for TopTaq Master Mix Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing PCR Conventional / Qualitative PCR - mammalian DNA using TopTaq Master Mix Kit from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.