Mastermix 16S Complete

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Amplicon size should be consistent for each target sequence and limited to approximately 65 - 100 bp.	PCR plates, tubes and pipette tips should be UV sterilized for 20-30 mins

Upstream tips
Amplicon size should be consistent for each target sequence and limited to approximately 65 - 100 bp.
Protocol tips
PCR plates, tubes and pipette tips should be UV sterilized for 20-30 mins

Publication protocol

Quantification of sample bacterial load by quantitative PCR (qPCR) of 16S rRNA DNA
Sample bacterial load was quantified by 16S rRNA qPCR of the urine DNA extracts (Mastermix 16S, Molzym, Bremen, Germany). The kit reagent was supplied as a 2.5 × mastermix which contained dNTPs, primers (343F 5′ TCCTACGGGAGGCAGCAGT 3′ and 809R 5′ GGACTACCAGGGTATCTAATCCTGTT 3′), Taq polymerase and SYBR fluorescent dye in a PCR buffer (exact content is proprietary). A volume of 15 μl of this secondary mix was then added to 10 μl of a 1/10 dilution of respective urine DNA extract/E. coli DNA calibrator. The supplied Taq was non hot-start; this necessitated assay set-up on ice, and the use of the PCR cycler plate to be preheated (95°C) in order to minimize primer-dimer formation (verified by melt curve analysis). The amount of urine extract DNA template was 20 to <1 ng/reaction (it was not possible to accurately quantify the amount of DNA in all extracts since some concentrations were <1 ng/μl). The total urine DNA extract volume was 50 μl which originated from 2 ml urine, and 10 μl of a 1/10 dilution of extract was added. The qPCR was calibrated using DNA obtained from an enumerated E. coli liquid culture (OD 600 nm of 1.5) extracted by the urine DNA protocol.

In our hands linearity of the enumerated E. coli DNA extract was observed over 6 dilution decades from an initial 200 ng/reaction to 200 fg/reaction (equivalent enumerated culture 7 × 106 to 70 cfu per reaction, 4.9 × 107 to 490 operon copies per reaction using a copy value of 7 operons per CFU; Klappenbach et al., 2001). This yielded a urine assay range (obtained by calculation from extraction factorization) of 1.75 × 108 to 1.75 × 103 E. coli cfu/ml which is 1.25 × 109 to 1.25 × 104 operon copies/ml equivalent. The qPCR assay was susceptible to primer-dimer interference. Optimization experiments indicated that under the employed conditions a false signal originated in the negative sample (blank) and low copy sample extracts at 30 cycles. This yielded a practical detection limit of 104 cfu/ml or 7 × 104 operon copies/ml.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing PCR Quantitative real-time PCR - Bacterial DNA using Mastermix 16S Complete from Molzym.

Manufacturer protocol

Download the product protocol from Molzym for Mastermix 16S Complete below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing PCR Quantitative real-time PCR - Bacterial DNA using Mastermix 16S Complete from Molzym. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.