pGL3-Basic Vector

Reporter gene assay luciferase - human embryonic stem cells

Experiment
Reporter gene assay luciferase - human embryonic stem cells
Product
pGL3-Basic Vector from Promega
Manufacturer
Promega

Protocol tips

Protocol tips
Transfect for 48h and harvest cells.

Publication protocol

The 5′-flanking region of SALL 4 was amplified with primers (5′ primer: GGTAC- GCGTAATAGGGCCAACCTCCATGGGAAG; 3′ primer: GCAAAGCTTCGACATGG- TGCGAGCATCGG) to generate a fragment from nucleolide (Nt) -1 to Nt-2102 upstream of the start codon ATG with MluI and HindIII sites at each end respectively. Genomic DNA isolated from human HEK293 cells was used as a template. The amplified PCR (polymerase chain reaction) fragment was cloned into the promoter-less pGL3-basic luciferase reporter plasmid (Promega, Madison, WI) to generate a SALL4 plasmid (P2102). The human OCT4 promoter reporter plasmid (Nt-1 to −1500), mouse Sall4 promoter fusion reporter plasmids containing fragments from Nt-1 to −2200, −645, −250, −190 and −l50 were created in the same manner as P2102.

Promoter luciferase assays were performed with the Dual-Luciferase Reporter Assay System (Promega, Madison WI), Twenty-four hours after transfection, cells were extracted with the use of a passive lysis buffer; a 20-µl aliquot was used for luminescence measurements with a luminometer. The data are represented as the ratio of firefly to Renilla luciferase activity (Fluc/Rluc). These experiments were performed in duplicate.

Full paper   Login or join for free to view the full paper.

Reviews

pGL3-Basic Vector from Promega has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

4 years ago

Author: J.Han China

Which transfection reagent would work better on stem cells?

I am planning on running reporter assays on stem cells and I would like to know which transfection reagent would work better?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Reporter gene assay luciferase - human embryonic stem cells using pGL3-Basic Vector from Promega.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Promega for pGL3-Basic Vector below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Reporter gene assay luciferase - human embryonic stem cells using pGL3-Basic Vector from Promega. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms