SV Total RNA Isolation System

RNA isolation / purification Cells - immortalized MDCK

Experiment
RNA isolation / purification Cells - immortalized MDCK
Product
SV Total RNA Isolation System from Promega
Manufacturer
Promega

Protocol tips

Protocol tips
For better lysis, pipet the RNA Lysis Buffer over the bottom of the well.

Publication protocol

Total RNA was extracted using the SV total RNA isolation system (Promega) in accordance with the manufacturer’s instructions. Equal amounts of RNA (500 ng) were used to synthesize the first-strand cDNA using the reverse transcriptase system and then PCR. Primers used for PCR were 5′ TCAGTGCAATTGGTGGAAAA 3′ (forward) and 5′ ACCTTGAGCGGAAACCAGTA 3′ (reverse) for CerS1, 5′ CCCACCTTGGAGCATTTCTA 3′ (forward) and 5′ TCGGGTGATGATGAAGACAA 3′ (reverse) for CerS2, 5′ GATT­TTGGCTTCCTCCAACA 3′ (forward) and 5′ GGGGTAGCCATTCCATACCT 3′ (reverse) for CerS3, 5′ TCCTACAGCTCCAACCTGCT 3′ (forward) and 5′ CTGGGCAATGGAGTCGTAGT 3′ (reverse) for CerS4, 5′ GTTCTG­GGACATCCGACAGT 3′ (forward) and 5′ TGAGCTGCTTTCCACATCAC 3′ (reverse) for CerS5, 5′ TAGCCAAACCATGTGCCATA 3′ (forward) and 5′ TGCCTTGTATTCCACAACCA 3′ (reverse) for CerS6, and 5′ ACCACAGTCCATGCCATCAC 3′ (forward), and 5′ ATGTCGTTGTC­CCA­CCACCT 3′ (reverse) for GAPDH. RT-PCR products were resolved on 2% agarose gels.

Full paper   Login or join for free to view the full paper.

Reviews

SV Total RNA Isolation System from Promega has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

4 years ago

Author: Switzerland

I am having trouble using the QiageN RNAeasy mini kit for CD34+ cells. Any tips?

I am having trouble using the QiageN RNAeasy mini kit for CD34+ cells. Any tips?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized MDCK using SV Total RNA Isolation System from Promega.

Paper title
Changes in ceramide metabolism are essential in Madin-Darby canine kidney cell differentiation
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Promega for SV Total RNA Isolation System below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized MDCK using SV Total RNA Isolation System from Promega. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms