illustra tissue and cells genomicPrep Mini Spin Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
		- Include RNAse treatment for 15-20 min. - Ensure EtOH is completely evaporated off of the column prior to elution. Adjust time from 1min to 5 min at 60`C - Use prewarmed TE buffer to elute the DNA

Downstream tips
- Include RNAse treatment for 15-20 min. - Ensure EtOH is completely evaporated off of the column prior to elution. Adjust time from 1min to 5 min at 60`C - Use prewarmed TE buffer to elute the DNA

Publication protocol

2.3.3. Polymerase chain reaction (PCR) for Leptospira spp.
The DNA from the blood and culture samples was extracted for PCR using the Illustra™ Blood Genomic Prep Mini Spin kit (GE Healthcare®), and the DNA from the kidney and liver samples was extracted using the Illustra™ Tissue and Cell Genomic Prep Mini Spin kit (GE Healthcare®), according to the recommendations of the manufacturer. The primers utilized were LEP 1 (5′ GGCGGCGCGTCTTAAACATG 3′) and LEP 2 (5′ TTCCCCCCATTGAGCAAGATT 3′), which amplify 331 base pairs (bp). PCR was used to detect Leptospira DNA using the rrs (16S) gene as the target sequence (Mérien et al., 1992).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing DNA isolation / purification Tissue - kidney using illustra tissue and cells genomicPrep Mini Spin Kit from GE Healthcare Life Sciences.

Manufacturer protocol

Download the product protocol from GE Healthcare Life Sciences for illustra tissue and cells genomicPrep Mini Spin Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing DNA isolation / purification Tissue - kidney using illustra tissue and cells genomicPrep Mini Spin Kit from GE Healthcare Life Sciences. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.