TRIzol Reagent

RNA isolation / purification Tissue - Human Tonsil

Experiment
RNA isolation / purification Tissue - Human Tonsil
Product
TRIzol Reagent from Thermo Fisher Scientific
Manufacturer
Thermo Fisher Scientific

Protocol tips

Protocol tips
- For low 260/230 readings the best approach is to try washing sample (precipitation) with ethanol to desalt it.

Publication protocol

The tonsil tissue was homogenized; total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, US) and 0.4 microgram of RNA was converted to cDNA using random primers and SuperScript II (Invitrogen, Carlsbad, CA). For PCR-DGGE analyses, each cDNA sample was amplified by PCR with universal bacterial primers 954f (cgcccgccgcgccccgcgcccggcccgccgcccccgccccgcacaagcggtggagcatgtgg) and 1396r (GCCCGGGAACGTATTCACCG) specific for V6 to V8 regions of the 16S rRNA gene

Full paper   Login or join for free to view the full paper.

Reviews

TRIzol Reagent from Thermo Fisher Scientific has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

4 years ago

Author: Paul G. Macon United States

RNA isolation from tissue

How do I extract RNA from animal tissue without using liquid nitrogen? I tried the RNA extraction by using the TRIzol reagent and I homogenize the tissue using polytron homogenizer at room temperature for 30secs is this correct?

Discussion

4 years ago

Author: Aaron Stege Netherlands

Problem in phase separation after using serum/plasma kit

I used a serum/plasma kit for my serum samples. After the phase separation the samples should have 3 phases: a colourless aqueous phase, a white interphase and a red organic phase. However, in some of my samples there was no aqueous phase unless I wait for an extended period of time. How can I circumvent this problem?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Tissue - Human Tonsil using TRIzol Reagent from Thermo Fisher Scientific.

Paper title
Periodontal Disease Bacteria Specific to Tonsil in IgA Nephropathy Patients Predicts the Remission by the Treatment
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for TRIzol Reagent below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Tissue - Human Tonsil using TRIzol Reagent from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms