TRIzol Reagent

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	- For low 260/230 readings the best approach is to try washing sample (precipitation) with ethanol to desalt it.

Protocol tips
- For low 260/230 readings the best approach is to try washing sample (precipitation) with ethanol to desalt it.

Publication protocol

Total RNA was isolated from dissected eyes or lenses with Trizol® Reagent (Invitrogen), contaminating DNA was eliminated by DNAse I digestion and RNA was repurified with RNeasy Micro kit (Qiagen). Random-primed cDNA was generated from 500 ng of total RNA using SuperScript VILO cDNA Synthesis kit (Invitrogen). Primers 5′ GTGAAGGAACCTTACTTCTGTGGTG 3′, and 5′ GTCCTTGGGGTCTTCTACCTTTCTC 3′, derived from the SV40 small T intron, were used for RT-PCR detection of transgenic CLEF mRNA. Total RNA was isolated from two lenses of one E16.5 embryo, or newborn with Trizol® Reagent. At least three different E16.5 embryos were used for total RNA isolation. Random-primed cDNA was generated from 200 ng of total RNA using SuperScript VILO cDNA Synthesis kit (Invitrogen) and two independent synthesis of cDNA were performed from one total RNA sampl

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Tissue - Mouse Lens using TRIzol Reagent from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for TRIzol Reagent below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Tissue - Mouse Lens using TRIzol Reagent from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.