ON-TARGETplus Human PLK1 (5347) siRNA - Individual

siRNA / miRNA gene silencing Human - MIA PaCa-2 PLK-1

Experiment
siRNA / miRNA gene silencing Human - MIA PaCa-2 PLK-1
Product
ON-TARGETplus Human PLK1 (5347) siRNA - Individual from Dharmacon
Manufacturer
Dharmacon

Protocol tips

Protocol tips
Plk1-Si1 siRNA-AACCAGUGGUUCGAGAGACAG

Add diluted siRNA to diluted Lipofectamine Reagent

Incubate for 5 min at RT and add to cells.

Incubate cells for 1–3 days at 37°C.

Publication protocol

Plk1 siRNAs were purchased from Dharmacon Research, Inc. (Lafayette, CO): Plk1-Si1 (AACCAGUGGUUCGAGAGACAG) and Plk1 Si1C (AACCAGUUUGGCGAGAGACAG). The selection of these sequences was based on the sequence of the best Plk1 AS oligo isis121969 (GAACCAGUGGUUCGAGAGACA) obtained from ISIS Pharmaceuticals (Carlsbad, CA; data not shown).

Transfection. siRNA was transfected using LipofectAMINE 2000 (LF2000) from Invitrogen (Carlsbad, CA) according to the manufacturer's instructions

Full paper   Login or join for free to view the full paper.

Reviews

ON-TARGETplus Human PLK1 (5347) siRNA - Individual from Dharmacon has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Human - MIA PaCa-2 PLK-1 using ON-TARGETplus Human PLK1 (5347) siRNA - Individual from Dharmacon.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Dharmacon for ON-TARGETplus Human PLK1 (5347) siRNA - Individual below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Human - MIA PaCa-2 PLK-1 using ON-TARGETplus Human PLK1 (5347) siRNA - Individual from Dharmacon. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Become shareholder Discussions About us Contact Privacy Terms