Target sequence1: Seq1-5'-GACTTCACGGGTGGTGTTTCT-3'

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Seed 5.0 × 10^5 cells	Add 4.5 μL Attractene Transfection Reagent to the DNA solution. Incubate the cells under their normal growth conditions and change medium after 6h and continue to incubate until 48 h

Upstream tips
Seed 5.0 × 10^5 cells
Protocol tips
Add 4.5 μL Attractene Transfection Reagent to the DNA solution. Incubate the cells under their normal growth conditions and change medium after 6h and continue to incubate until 48 h

Publication protocol

Four unique short hairpin RNA (shRNA) sequences that target human CAPN5 and one nontargeting sequence (negative control) were purchased from Qiagen (Catalog# KM40517; Frederick, MD). Each plasmid vector expressed a shRNA under the control of a U1 promoter and contained a green fluorescent protein (GFP) reporter gene. The shRNA nucleotide sequences were: clone one: 5’ - GTACAATGTGAAAGGCATCTT - 3’; clone two: 5’ - CAACCACAAGGACACCTTCTT - 3’; clone three: 5’ - GACTTCACGGGTGGTGTTTCT - 3’; clone four: 5’ - GTCAGAGAAGTTGGTGTTTCT - 3’; negative control: 5’ - GGAATCTCA TTCGATGCATAC - 3’.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing shRNA gene silencing Human - HEK 293T CAPN5- (Calpains) cationic lipid based using Target sequence1: Seq1-5'-GACTTCACGGGTGGTGTTTCT-3' from Custom made.

Manufacturer protocol

Download the product protocol from Custom made for Target sequence1: Seq1-5'-GACTTCACGGGTGGTGTTTCT-3' below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing shRNA gene silencing Human - HEK 293T CAPN5- (Calpains) cationic lipid based using Target sequence1: Seq1-5'-GACTTCACGGGTGGTGTTTCT-3' from Custom made. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.