siRNA / miRNA gene silencing Rat - Intestinal epithelial cells (IEC-6) HuR Lipid

Start discussion

No discussions found

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Found 1 matching solution for this experiment

HuR siRNA + Lipofectamine® 2000 Transfection Reagent

HuR siRNA

Santa Cruz Biotechnology

Protocol tips
siRNA sequence: 5′AACACGCTGAACGGCTTGAGG

siRNA concentratin:Mix 20-mM stock duplex siHuR with 300 μl of Opti-MEM medium.

Incubate for 20 min at room temperature and gently add to cells.

Incubate cells for 48 h at 37°C
Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product!
Become shareholder Discussions About us Contact Privacy Terms