siRNA / miRNA gene silencing Rat - RBL-2H3 Orai1

miRNA is the inherent gene silencing machinery which can have more than one mRNA target, whereas siRNA can be designed to target a particular mRNA target. By design, both siRNA and miRNA are 20-25 nucleotides in length. The target sequence for siRNAs is usually located within the open reading frame, between 50 and 100 nucleotides downstream of the start codon. There are two ways in which cells can be transfected with desired RNAi: 1. Direct transfection (with calcium phosphate co-precipitation or cationic lipid mediated transfection using lipofectamine or oligofectamine), and 2. Making RNAi lentiviral constructs (followed by transformation and transduction). Lentiviral constructs are time consuming, but provide a more permanent expression of RNAi in the cells, and consistent gene silencing. Direct transfection of oligonucleotides provides temporary genetic suppression. Traditional methods like calcium phosphate co-precipitation have challenges like low efficiency, poor reproducibility and cell toxicity. Whereas, cationic lipid-based transfection reagents are able to overcome these challenges, along with applicability to a large variety of eukaryotic cell lines. When using oligos, the ideal concentration lies between 10-50nM for effective transfection.

1 Matching solution
Start a discussion

Start discussion

No discussions found

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Found 1 matching solution for this experiment

Orai1 Rat siRNA Oligo Duplex (Locus ID 304496)

OriGene

Upstream tips	Protocol tips	Downstream tips
	For siRNA and cDNA transfection, the Amaxa electroporation system was used (23) with the Amaxa cell line nucleofactor kit Transfection efficiency, judged by GFP fluorescence following transfection with a GFP plasmid, was typically 50– 60%. STIM1 siRNA was purchased from Life Technologies (catalog no. 4390815). Orai1 siRNA was bought from Origene Technologies (catalog no. SR508429), and the sequences (5 to 3 ) were AGUUCUUACCGCUCAAGAGGCAGGC, CCAUAAGACGGACCGACAGUUCCAG, and AGGGCAGAGUGUGGAAGGAAGAGGC. Both STIM1 and Oria1 siRNAs were used at a final concentration of 50 nM. PIP5K1 and PIP5K1 siRNAs and scrambled siRNA were purchased from Dharmacon and used at a final concentration of 75 nM. The PIP5K1 sequences (5 to 3 ) were CGGCAAGAACAUACGAAUU, GCAUCCGGCCUGACGAUUA, GCCCAUGAACAGCGAAAACA, and GAAAAUAGGCCAUCGAAGU. The PIP5K1 sequences (5 to 3 ) were UCUGGAGAGACUACGUAUA, GCUUCUAUGCCGAGCGCUU, GAGAGGAUGUGCAGUACGA, and GGAGGAGCUGCAUGCGGAA. Talin1 and talin2 siRNAs were from Dharmacon and used at 50 nM. The Talin1 SMARTpool sequences were CGAGAACUAUGCAGGUAUU, CGAAUGACCAAGGGUAUUA, GUUCGUAGAUUAUCAGACA, and GAGAUGAAGAGUCUACUAU. The Talin2 SMARTpool sequences were UGUUAGUACUCAAGGCGAA, CCGCAAUAAGUGUCGAAUU, CCGCAAAGCUCUUGGCCGA, and GCUAGAAGCAGGUCGGACA.

Protocol tips
For siRNA and cDNA transfection, the Amaxa electroporation system was used (23) with the Amaxa cell line nucleofactor kit Transfection efficiency, judged by GFP fluorescence following transfection with a GFP plasmid, was typically 50– 60%. STIM1 siRNA was purchased from Life Technologies (catalog no. 4390815). Orai1 siRNA was bought from Origene Technologies (catalog no. SR508429), and the sequences (5 to 3 ) were AGUUCUUACCGCUCAAGAGGCAGGC, CCAUAAGACGGACCGACAGUUCCAG, and AGGGCAGAGUGUGGAAGGAAGAGGC. Both STIM1 and Oria1 siRNAs were used at a final concentration of 50 nM. PIP5K1 and PIP5K1 siRNAs and scrambled siRNA were purchased from Dharmacon and used at a final concentration of 75 nM. The PIP5K1 sequences (5 to 3 ) were CGGCAAGAACAUACGAAUU, GCAUCCGGCCUGACGAUUA, GCCCAUGAACAGCGAAAACA, and GAAAAUAGGCCAUCGAAGU. The PIP5K1 sequences (5 to 3 ) were UCUGGAGAGACUACGUAUA, GCUUCUAUGCCGAGCGCUU, GAGAGGAUGUGCAGUACGA, and GGAGGAGCUGCAUGCGGAA. Talin1 and talin2 siRNAs were from Dharmacon and used at 50 nM. The Talin1 SMARTpool sequences were CGAGAACUAUGCAGGUAUU, CGAAUGACCAAGGGUAUUA, GUUCGUAGAUUAUCAGACA, and GAGAUGAAGAGUCUACUAU. The Talin2 SMARTpool sequences were UGUUAGUACUCAAGGCGAA, CCGCAAUAAGUGUCGAAUU, CCGCAAAGCUCUUGGCCGA, and GCUAGAAGCAGGUCGGACA.

Protocol tips

For siRNA and cDNA transfection, the Amaxa electroporation system was used (23) with the Amaxa cell line nucleofactor kit Transfection efficiency, judged by GFP fluorescence following transfection with a GFP plasmid, was typically 50– 60%. STIM1 siRNA was purchased from Life Technologies (catalog no. 4390815). Orai1 siRNA was bought from Origene Technologies (catalog no. SR508429), and the sequences (5 to 3 ) were AGUUCUUACCGCUCAAGAGGCAGGC, CCAUAAGACGGACCGACAGUUCCAG, and AGGGCAGAGUGUGGAAGGAAGAGGC. Both STIM1 and Oria1 siRNAs were used at a final concentration of 50 nM. PIP5K1 and PIP5K1 siRNAs and scrambled siRNA were purchased from Dharmacon and used at a final concentration of 75 nM. The PIP5K1 sequences (5 to 3 ) were CGGCAAGAACAUACGAAUU, GCAUCCGGCCUGACGAUUA, GCCCAUGAACAGCGAAAACA, and GAAAAUAGGCCAUCGAAGU. The PIP5K1 sequences (5 to 3 ) were UCUGGAGAGACUACGUAUA, GCUUCUAUGCCGAGCGCUU, GAGAGGAUGUGCAGUACGA, and GGAGGAGCUGCAUGCGGAA. Talin1 and talin2 siRNAs were from Dharmacon and used at 50 nM. The Talin1 SMARTpool sequences were CGAGAACUAUGCAGGUAUU, CGAAUGACCAAGGGUAUUA, GUUCGUAGAUUAUCAGACA, and GAGAUGAAGAGUCUACUAU. The Talin2 SMARTpool sequences were UGUUAGUACUCAAGGCGAA, CCGCAAUAAGUGUCGAAUU, CCGCAAAGCUCUUGGCCGA, and GCUAGAAGCAGGUCGGACA.

Manufacturer protocol Publication protocol 1 Relevant paper

Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product!

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

Outsource experiment