psiCHECK-2vector

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Modify vector by deleting the BamHI site between the firefly luciferase gene and β-lactamase (Ampr) coding region, to alter MCR region that contain XhoI and BamHI sites

Protocol tips
Modify vector by deleting the BamHI site between the firefly luciferase gene and β-lactamase (Ampr) coding region, to alter MCR region that contain XhoI and BamHI sites

Publication protocol

To express miRNA, a pLL3.7 vector was first modified by the insertion of an overlap extension PCR (OE-PCR) product containing multiple cloning sites, the miRNA transcriptional stop sequence 5′-TTTTT-3′ and the puromycin resistant gene driven by the SV40 early promoter, downstream of the human U6 promoter. The SV40 early promoter was PCR amplified from pcDNA3.1 using the forward primer (primer 1, 5′- CTCGAGAACCCGGGATCCTTTTTATTTAACGCGAATTAATTCTGTGGAA-3′) with XhoI, SmaI and BamHI restriction sites (underlined) followed by a transcriptional stop sequence of the U6 promoter, 5′-TTTTT-3′, at the 5′ terminus. The reverse primer (primer 2, 5′- TACTCGGTCATGCTAGCCGGGAGCTTTTTGCAAAAGCCTAG-3′) with an 11 nt overlap sequence of puromycin PCR products was followed by a NheI restriction site (underlined) linked at the 5′ terminus. The puromycin resistant gene was amplified from pCDH-CMV-MCS-EF1-Puro_CD510B-1 using a forward primer (primer 3, 5′- GCAAAAAGCTCCCGGCTAGCATGACCGAGTACAAGCCCACGGTGC-3′) that contained a 14 nt overlap sequence with the SV40 early promoter PCR product and a NheI restriction site (underlined). The reverse primer (primer 4, 5′-TTTTTGTCGACGAATTCTCAGGCACCGGGCTTGCGGGTCATGC-3′) included SalI restriction sites. Then an overlap extension PCR (OE-PCR) was carried out with a combination of the above two PCR fragments and amplification with primers 1 and 4. The final PCR product was digested with SalI and inserted into the pLL3.7 plasmid that was digested by HpaI and XhoI. This modified pLL3.7 was named pLE. To construct the human miRNA expression library, a genomic fragment containing the human miRNA precursor and flanking sequences was amplified for each miRNA and cloned into the pLE vector using XhoI and BamHI double digestion.

To construct luciferase reporter vectors, the psiCHECK-2 (Promega) vector was modified by deletion of the BamHI site between the firefly luciferase gene and β-lactamase (Ampr) coding region, the multiple cloning region was altered to contain XhoI and BamHI sites. The full-length 3′UTRs of seven human genes MXI1, TP53, PTEN, CYP3A4, FSCN1, POT1 and TRF2 or the 3′UTR fragments containing the putative miR-101-3p or miR-10b-5p binding sequences of human EZH2 or HoxD10 were amplified using the primers listed in Table S1 and were cloned downstream of the Renilla luciferase in the modified psiCHECK-2 vector using XhoI/SalI and BamHI/BglII double digestion. The mutant luciferase reporter constructs carrying mutations in the sequence of the complementary miRNA seed region sites were generated by site-directed mutagenesis using overlap extension PCR, as described previously [29].

The miRNA sensor was made by tandemly linking 2 or 4 copies of complementary sequences of the mature miRNA together and they were cloned downstream of the Renilla luciferase (Rluc) gene in a modified psiCHECK-2 vector, as described by Ebert et al. [30]. The synthesized oligos for sensor cloning are listed in Table S2.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Reporter gene assay luciferase - HEK 293 human embryonic kidney cells using psiCHECK-2vector from Promega.

Manufacturer protocol

Download the product protocol from Promega for psiCHECK-2vector below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Reporter gene assay luciferase - HEK 293 human embryonic kidney cells using psiCHECK-2vector from Promega. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.