EZ-Magna ChIP™ HiSens Chromatin Immunoprecipitation Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
-Do not use formaldehyde if white precipitate is visible in the solution.	-Use ChIP validated antibody. - 1X104 cells per ChIP when using high affinity antibodies directed towards more abundant proteins. -Protease Inhibitor Cocktail III contains DMSO and will remain frozen below 18.4°C. -Keep cell lysate ice cold. Sonication produces heat, which can denature the chromatin. Allow at least 30 seconds between cycles of sonication to prevent sample overheating.

Upstream tips
-Do not use formaldehyde if white precipitate is visible in the solution.
Protocol tips
-Use ChIP validated antibody. - 1X104 cells per ChIP when using high affinity antibodies directed towards more abundant proteins. -Protease Inhibitor Cocktail III contains DMSO and will remain frozen below 18.4°C. -Keep cell lysate ice cold. Sonication produces heat, which can denature the chromatin. Allow at least 30 seconds between cycles of sonication to prevent sample overheating.

Publication protocol

HSCs on 0.4 kPa, 25.6 kPa, or a culture dish, were harvested for ChIP. ChIP was performed
using an EZ-Magna-ChIP HiSens kit (Millipore, 17-10461) as we previously described9
. In brief,
HSCs fixed with 1% formaldehyde and scraped from a polyacrylamide gel or culture plate were
subjected to nuclear lysis to release cross-linked protein/DNAs. The nuclear extract was then
subjected to sonication and immunoprecipitation with anti-histone H3 -acetyl K27 antibody
(H3K27AC) (Abcam, ab4729) or control rabbit IgG (Santa Cruz Technology, sc-2027).
Precipitated DNA fragments containing CXCL12 promotor were quantitated by qPCR with 2
different pairs of primers. Primer pair 1: forward: AGTTTTCTGGACCCAGAAGGC and reverse:
GCATCGTGTCTGACAAGCAGAC; primer pair 2: forward: AGCCCCCACGCACAGAAA and
reverse: TTAGGCGTAAAGTGGGGCGC.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Mouse - HSC using EZ-Magna ChIP™ HiSens Chromatin Immunoprecipitation Kit from Merck Millipore.

Manufacturer protocol

Download the product protocol from Merck Millipore for EZ-Magna ChIP™ HiSens Chromatin Immunoprecipitation Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Mouse - HSC using EZ-Magna ChIP™ HiSens Chromatin Immunoprecipitation Kit from Merck Millipore. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.