Protein Expression Prokaryotic cells - L. lactis Cry5B

Protein expression refers to the techniques in which a protein of interest is synthesized, modified or regulated in cells. The blueprints for proteins are stored in DNA which is then transcribed to produce messenger RNA (mRNA). mRNA is then translated into protein. In prokaryotes, this process of mRNA translation occurs simultaneously with mRNA transcription. In eukaryotes, these two processes occur at separate times and in separate cellular regions (transcription in nucleus and translation in the cytoplasm). Recombinant protein expression utilizes cellular machinery to generate proteins, instead of chemical synthesis of proteins as it is very complex. Proteins produced from such DNA templates are called recombinant proteins and DNA templates are simple to construct. Recombinant protein expression involves transfecting cells with a DNA vector that contains the template. The cultured cells can then transcribe and translate the desired protein. The cells can be lysed to extract the expressed protein for subsequent purification. Both prokaryotic and eukaryotic protein expression systems are widely used. The selection of the system depends on the type of protein, the requirements for functional activity and the desired yield. These expression systems include mammalian, insect, yeast, bacterial, algal and cell-free. Each of these has pros and cons. Mammalian expression systems can be used for transient or stable expression, with ultra high-yield protein expression. However, high yields are only possible in suspension cultures and more demanding culture conditions. Insect cultures are the same as mammalian, except that they can be used as both static and suspension cultures. These cultures also have demanding culture conditions and may also be time-consuming. Yeast cultures can produce eukaryotic proteins and are scalable, with minimum culture requirements. Yeast cultures may require growth culture optimization. Bacterial cultures are simple, scalable and low cost, but these may require protein-specific optimization and are not suitable for all mammalian proteins. Algal cultures are optimized for robust selection and expression, but these are less developed than other host platforms. Cell-free systems are open, free of any unnatural compounds, fast and simple. This system is, however, not optimal for scaling up.

Start discussion

No discussions found

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Found 2 matching solutions for this experiment

pTRK1061

Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri

Upstream tips
Cloning for Cry5B expression by the leaky Lactococcus system was accomplished using vector pTRK1061. The vector was constructed from pTRK617 (24) by using an XhoI/SalI double digest and religation, removing the tetanus toxin fragment C (TTFC) gene. The following primers were used to amplify cry5B from pTRK1040: forward, Cry5B RBS PstI (GATCCTGCAGAAGGAGAACGTATATGGCAACAATTAATGAGTTGTATC); and reverse, Cry5B XhoI R (GATCCTCGAGTATCCAAGCTCAGCTAATTAAG). The reverse primer for truncated Cry5B was tCry5B XhoI R (GATCCTCGAGATCAGTCTATTGGATTTTTGGAAC). The Cry5B fragments and vector pTRK1061 were digested with PstI and XhoI and ligated.
pMSP3535H3

Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri

Upstream tips
For nisin-induced expression of Cry5B by use of vector pMSP3535H3, full-length and truncated cry5B genes were PCR amplified from pTRK1040 by using the following primers: cry5B SphI forward (GATCGCATGCGTGAGGAGAACGTATATGGCAACAATTAATGAGTTG) and cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). Truncated Cry5B was amplified with truncated cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). The PCR products were cloned into vector pSC-B by using a StrataClone Blunt PCR cloning kit, and from there into pMSP3535H3 by using the SphI and BamHI restriction sites encoded in the PCR primers.
Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product!

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms