No discussions found
Start your discussion
Share your thoughts or question with experts in your field
Start a discussion
Found 2 matching solutions for this experiment
pTRK1061
Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri
Upstream tips |
Protocol tips |
Downstream tips |
Cloning for Cry5B expression by the leaky Lactococcus system was accomplished using vector pTRK1061. The vector was constructed from pTRK617 (24) by using an XhoI/SalI double digest and religation, removing the tetanus toxin fragment C (TTFC) gene. The following primers were used to amplify cry5B from pTRK1040: forward, Cry5B RBS PstI (GATCCTGCAGAAGGAGAACGTATATGGCAACAATTAATGAGTTGTATC); and reverse, Cry5B XhoI R (GATCCTCGAGTATCCAAGCTCAGCTAATTAAG). The reverse primer for truncated Cry5B was tCry5B XhoI R (GATCCTCGAGATCAGTCTATTGGATTTTTGGAAC). The Cry5B fragments and vector pTRK1061 were digested with PstI and XhoI and ligated. |
|
|
Upstream tips |
Cloning for Cry5B expression by the leaky Lactococcus system was accomplished using vector pTRK1061. The vector was constructed from pTRK617 (24) by using an XhoI/SalI double digest and religation, removing the tetanus toxin fragment C (TTFC) gene. The following primers were used to amplify cry5B from pTRK1040: forward, Cry5B RBS PstI (GATCCTGCAGAAGGAGAACGTATATGGCAACAATTAATGAGTTGTATC); and reverse, Cry5B XhoI R (GATCCTCGAGTATCCAAGCTCAGCTAATTAAG). The reverse primer for truncated Cry5B was tCry5B XhoI R (GATCCTCGAGATCAGTCTATTGGATTTTTGGAAC). The Cry5B fragments and vector pTRK1061 were digested with PstI and XhoI and ligated. |
pMSP3535H3
Todd R. Klaenhammer, Department of Food, Bioprocessing and Nutri
Upstream tips |
Protocol tips |
Downstream tips |
For nisin-induced expression of Cry5B by use of vector pMSP3535H3, full-length and truncated cry5B genes were PCR amplified from pTRK1040 by using the following primers: cry5B SphI forward (GATCGCATGCGTGAGGAGAACGTATATGGCAACAATTAATGAGTTG) and cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). Truncated Cry5B was amplified with truncated cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). The PCR products were cloned into vector pSC-B by using a StrataClone Blunt PCR cloning kit, and from there into pMSP3535H3 by using the SphI and BamHI restriction sites encoded in the PCR primers. |
|
|
Upstream tips |
For nisin-induced expression of Cry5B by use of vector pMSP3535H3, full-length and truncated cry5B genes were PCR amplified from pTRK1040 by using the following primers: cry5B SphI forward (GATCGCATGCGTGAGGAGAACGTATATGGCAACAATTAATGAGTTG) and cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). Truncated Cry5B was amplified with truncated cry5B BamHI reverse (GATCGGATCCGCAGTATCCAAGCTCAGCTAATTAAG). The PCR products were cloned into vector pSC-B by using a StrataClone Blunt PCR cloning kit, and from there into pMSP3535H3 by using the SphI and BamHI restriction sites encoded in the PCR primers. |
Can't find the product you've used to perform this experiment? It would be great if you can help us by
Adding a product!