shRNA gene silencing Human - SiHa AEG-1

Short hairpin or small hairpin RNA (shRNA) is artificial RNA, which has a hairpin loop structure, and uses inherent microRNA (miRNA) machinery to silence target gene expression. This is called RNA interference (RNAi). These can be delivered via plasmids or viral/bacterial vectors. Challenges in shRNA-mediated gene silencing include 1. Off-target silencing, 2. Packaging shRNA encoding lentivirus, and 3. Stable transduction in cells. RNAi has been designed to have anywhere from 19-27 bs, but the most effective design has 19 bp. In case commercial shRNAs are not available, potential target sites can be chosen within exon, 5’- or 3’ UTR, depending on which splice variants of the gene are desired. One should use the latest algorithms and choose at least two different sequences, targeting different regions, in order to have confidence in overcoming off-target effects. A BLAST search after selecting potential design will eliminate potential off-target sequences. For the second challenge, sequencing the vector using primers for either strand (50-100 bp upstream) is suggested, along with using enzymatic digestion on agarose gel for the vector. Next, once the shRNA-containing vector is packaged in a virus, it is important to check the viral titer before transduction. Finally, using a marker in the lentiviral vector (fluorescent protein or antibiotic resistance), along with qPCR for target gene expression can help in determining the efficacy of transduction and shRNA on its target site.

1 Matching solution
1 Discussion

Start discussion

Found 1 discussion for this experiment

Discussion

4 years ago

4 years ago by Eufrosina Sagese Italy

Is a knockdown using shRNA permanent?

Is a knockdown using shRNA permanent and if not is there a known duration?

Comment View 6 comments

Share your thoughts or question with experts in your field by adding a discussion!

Found 1 matching solution for this experiment

pSilencer™ 4.1-CMV neo

Thermo Fisher Scientific

Upstream tips	Protocol tips	Downstream tips
	The human cervical carci¬noma cell lines SiHa was purchased from the American Type Culture Collection (ATCC) and cultured in complete RPMI-1640 medium (Gibco, Grand Island, NY, USA). shRNA expression vectors were generated by annealing single-stranded oligonu¬cleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). The target sequences were as follows: shA1 (AEG-1; GenBank, AF411226.1; 1825 1843 bp): 5'-GTGCCG CCAATACTACAAG-3' (recommended by P.B. Fisher, Departments of Pathology and Urology, Columbia University, USA); shA2 (AEG-1; GenBank, AF411226.1; 666-686 bp): AACAGAAGAAGAAGAACCGGA (27); and a scrambled sequence was used as a negative control (NC): 5'-TTCTCC GAACGTGTCACGT-3' (provided by Ambion). The recombi¬nant shRNA vectors were named pshA1, pshA2 and pshNC. The full length open reading frame cDNA of AEG-1 was amplified using RT-PCR from total mRNA of HeLa cells, and then inserted into the pcDNA3.1 expression vector; the recom¬binant vector was named pAEG1. All recombinant vectors were confirmed by enzyme digestion and DNA sequencing analysis. Cell transfection was performed using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions and selected with 600 μg/ml of G418 (Invitrogen, San Diego, CA, USA) after transfection.

Protocol tips
The human cervical carci¬noma cell lines SiHa was purchased from the American Type Culture Collection (ATCC) and cultured in complete RPMI-1640 medium (Gibco, Grand Island, NY, USA). shRNA expression vectors were generated by annealing single-stranded oligonu¬cleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). The target sequences were as follows: shA1 (AEG-1; GenBank, AF411226.1; 1825 1843 bp): 5'-GTGCCG CCAATACTACAAG-3' (recommended by P.B. Fisher, Departments of Pathology and Urology, Columbia University, USA); shA2 (AEG-1; GenBank, AF411226.1; 666-686 bp): AACAGAAGAAGAAGAACCGGA (27); and a scrambled sequence was used as a negative control (NC): 5'-TTCTCC GAACGTGTCACGT-3' (provided by Ambion). The recombi¬nant shRNA vectors were named pshA1, pshA2 and pshNC. The full length open reading frame cDNA of AEG-1 was amplified using RT-PCR from total mRNA of HeLa cells, and then inserted into the pcDNA3.1 expression vector; the recom¬binant vector was named pAEG1. All recombinant vectors were confirmed by enzyme digestion and DNA sequencing analysis. Cell transfection was performed using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions and selected with 600 μg/ml of G418 (Invitrogen, San Diego, CA, USA) after transfection.

Protocol tips

The human cervical carci¬noma cell lines SiHa was purchased from the American Type Culture Collection (ATCC) and cultured in complete RPMI-1640 medium (Gibco, Grand Island, NY, USA). shRNA expression vectors were generated by annealing single-stranded oligonu¬cleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). The target sequences were as follows: shA1 (AEG-1; GenBank, AF411226.1; 1825 1843 bp): 5'-GTGCCG CCAATACTACAAG-3' (recommended by P.B. Fisher, Departments of Pathology and Urology, Columbia University, USA); shA2 (AEG-1; GenBank, AF411226.1; 666-686 bp): AACAGAAGAAGAAGAACCGGA (27); and a scrambled sequence was used as a negative control (NC): 5'-TTCTCC GAACGTGTCACGT-3' (provided by Ambion). The recombi¬nant shRNA vectors were named pshA1, pshA2 and pshNC. The full length open reading frame cDNA of AEG-1 was amplified using RT-PCR from total mRNA of HeLa cells, and then inserted into the pcDNA3.1 expression vector; the recom¬binant vector was named pAEG1. All recombinant vectors were confirmed by enzyme digestion and DNA sequencing analysis. Cell transfection was performed using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions and selected with 600 μg/ml of G418 (Invitrogen, San Diego, CA, USA) after transfection.

Publication protocol 1 Relevant paper

Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product!

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

Outsource experiment