siRNA / miRNA gene silencing Human - A172 PLK1

Gene silencing through the use of small interfering RNA (siRNA) has become a primary tool for identifying disease-causing genes. There are several aspects for preparing and delivering effective siRNA to knockdown a target gene. The length of siRNA should be 21–23nt long with G/C content 30–50%. If a validated siRNA sequence for your target gene is not available, use siRNA generated against the entire target gene ORF. Always work with two or three different siRNA constructs to get reliable results. If you are not sure how much siRNA to use for a given experiment, start with a transfection concentration of 10-50 nM and use siRNA-specific transfection reagent to ensure efficient siRNA delivery in a wide range of cells.

Start discussion

No discussions found

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Found 1 matching solution for this experiment

Hs_PLK1_7 FlexiTube siRNA + FuGENE® 6 Transfection Reagent

Protocol tips
Hs_PLK1_7:CGCGGGCAAGATTGTGCCTAA

Final concentration of 15 nM.

Incubate the FuGENE 6 Transfection Reagent/medium mixture for 5 minutes at room temperature.

Incubate transfection mixture for 15 min at room temperature and add to cells and shake for 10-30 seconds.

Incubate cells for 24-48 h.
Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product!

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms