siRNA / miRNA gene silencing Human - HeLa γ1-adaptin/AP1G1

miRNA is the inherent gene silencing machinery which can have more than one mRNA target, whereas siRNA can be designed to target a particular mRNA target. By design, both siRNA and miRNA are 20-25 nucleotides in length. The target sequence for siRNAs is usually located within the open reading frame, between 50 and 100 nucleotides downstream of the start codon. There are two ways in which cells can be transfected with desired RNAi: 1. Direct transfection (with calcium phosphate co-precipitation or cationic lipid mediated transfection using lipofectamine or oligofectamine), and 2. Making RNAi lentiviral constructs (followed by transformation and transduction). Lentiviral constructs are time consuming, but provide a more permanent expression of RNAi in the cells, and consistent gene silencing. Direct transfection of oligonucleotides provides temporary genetic suppression. Traditional methods like calcium phosphate co-precipitation have challenges like low efficiency, poor reproducibility and cell toxicity. Whereas, cationic lipid-based transfection reagents are able to overcome these challenges, along with applicability to a large variety of eukaryotic cell lines. When using oligos, the ideal concentration lies between 10-50nM for effective transfection.

1 Matching solution
Start a discussion

Start discussion

No discussions found

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Found 1 matching solution for this experiment

siGENOME Human AP1G1 (164) siRNA - SMARTpool

Horizon Discovery Ltd.

Upstream tips	Protocol tips	Downstream tips
	RNAi was performed using siRNAs (Dharmacon, Lafayette, CO) designed to the following human target sequences: AAUGCUCAGCAUCAGAGGCUC for the coding sequence of p56, AAGAAUGGAUUGAUGAU for the 5′ untranslated region of p56 (p56-5′), CAUCGUGUUCCAGUCAGCU for GGA1, UACACCUCUGGCUCAAGUG for GGA2, CAGUUUGUCCUCCGUGUUGG for GGA3, and UCCAAUUCGAAGACCAAUU for CHC. For the design of the siRNAs to the GGAs, an alignment of the cDNAs of the human sequences (Accession numbers: NM_013365 for GGA1; NM_015044 for GGA2; and NM_014001 for GGA3), using the multiple sequence alignment algorithm ClustalW (Thompson et al., 1994), was performed. We selected 18–20-base oligonucleotides directed to regions in the aligned coding sequences with the lowest degree of identity among the GGAs. Oligonucleotides with the ability to produce a knockdown of ≥90%, as assessed by immunoblot analysis, were chosen for further experiments. RNAi for human γ1-adaptin was performed with siGENOME Smart Pool siRNAs (Dharmacon). RNAi for GAPDH was performed with a siControl duplex siRNA (Dharmacon). Cells were transfected with the siRNAs using Oligofectamine (Invitrogen) according to the manufacturer's protocol. For knockdown of the GGAs, cells were transfected twice at 72-h intervals and analyzed 72 h after the second round of transfection. For knockdown of GAPDH, p56, γ1-adaptin, and CHC cells were transfected twice at 24-h intervals and analyzed 48 h after the second round of transfection.

Protocol tips
RNAi was performed using siRNAs (Dharmacon, Lafayette, CO) designed to the following human target sequences: AAUGCUCAGCAUCAGAGGCUC for the coding sequence of p56, AAGAAUGGAUUGAUGAU for the 5′ untranslated region of p56 (p56-5′), CAUCGUGUUCCAGUCAGCU for GGA1, UACACCUCUGGCUCAAGUG for GGA2, CAGUUUGUCCUCCGUGUUGG for GGA3, and UCCAAUUCGAAGACCAAUU for CHC. For the design of the siRNAs to the GGAs, an alignment of the cDNAs of the human sequences (Accession numbers: NM_013365 for GGA1; NM_015044 for GGA2; and NM_014001 for GGA3), using the multiple sequence alignment algorithm ClustalW (Thompson et al., 1994), was performed. We selected 18–20-base oligonucleotides directed to regions in the aligned coding sequences with the lowest degree of identity among the GGAs. Oligonucleotides with the ability to produce a knockdown of ≥90%, as assessed by immunoblot analysis, were chosen for further experiments. RNAi for human γ1-adaptin was performed with siGENOME Smart Pool siRNAs (Dharmacon). RNAi for GAPDH was performed with a siControl duplex siRNA (Dharmacon). Cells were transfected with the siRNAs using Oligofectamine (Invitrogen) according to the manufacturer's protocol. For knockdown of the GGAs, cells were transfected twice at 72-h intervals and analyzed 72 h after the second round of transfection. For knockdown of GAPDH, p56, γ1-adaptin, and CHC cells were transfected twice at 24-h intervals and analyzed 48 h after the second round of transfection.

Protocol tips

RNAi was performed using siRNAs (Dharmacon, Lafayette, CO) designed to the following human target sequences: AAUGCUCAGCAUCAGAGGCUC for the coding sequence of p56, AAGAAUGGAUUGAUGAU for the 5′ untranslated region of p56 (p56-5′), CAUCGUGUUCCAGUCAGCU for GGA1, UACACCUCUGGCUCAAGUG for GGA2, CAGUUUGUCCUCCGUGUUGG for GGA3, and UCCAAUUCGAAGACCAAUU for CHC. For the design of the siRNAs to the GGAs, an alignment of the cDNAs of the human sequences (Accession numbers: NM_013365 for GGA1; NM_015044 for GGA2; and NM_014001 for GGA3), using the multiple sequence alignment algorithm ClustalW (Thompson et al., 1994), was performed. We selected 18–20-base oligonucleotides directed to regions in the aligned coding sequences with the lowest degree of identity among the GGAs. Oligonucleotides with the ability to produce a knockdown of ≥90%, as assessed by immunoblot analysis, were chosen for further experiments. RNAi for human γ1-adaptin was performed with siGENOME Smart Pool siRNAs (Dharmacon). RNAi for GAPDH was performed with a siControl duplex siRNA (Dharmacon). Cells were transfected with the siRNAs using Oligofectamine (Invitrogen) according to the manufacturer's protocol. For knockdown of the GGAs, cells were transfected twice at 72-h intervals and analyzed 72 h after the second round of transfection. For knockdown of GAPDH, p56, γ1-adaptin, and CHC cells were transfected twice at 24-h intervals and analyzed 48 h after the second round of transfection.

Manufacturer protocol Publication protocol 1 Relevant paper

Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product!

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

Outsource experiment