siRNA / miRNA gene silencing Human - U87MG HES6

Start discussion

No discussions found

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Found 1 matching solution for this experiment

Hs_HES6_1 FlexiTube siRNA. + FuGENE® 6 Transfection Reagent

Protocol tips
siRNA-Hs_HES6_1: TTGGAGTTAGTTACCCTTGAA

Final concentration of 15 nM each, or as a pool of three siRNAs (denoted as siHES6) 10 nM each.

Incubate the FuGENE 6 Transfection Reagent/medium mixture for 5 minutes at room temperature 

Incubate transfection mixture for 15 min at room temperature and add to cells and shake for 10-30 seconds. 

Incubate cells for 24-48 h. 
Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product!

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms