siRNA / miRNA gene silencing Rat - Glial cells GLT-1

Start discussion

No discussions found

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Found 1 matching solution for this experiment

Slc1a2 + I-FECT

Slc1a2

Thermo Fisher Scientific

I-FECT

Neuromics

Protocol tips
GLT-1 (#1: UAACUUCAUGACAAUCUCGTT, #2:UCGUGGACAUGUAAUAUACAA)

Seed 3 x 10^5 cells/well in a 12 well plate.

Transfect with 1 μg siRNA in a media containing 5mM glutamate and incubate at 37°C with 5% CO2 overnight.

For 7 days knockdown experiment, transfect cells on day 0 and day 3.
Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product!

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms