siRNA / miRNA gene silencing Rat - H9c2 AIF/Pdcd8

miRNA is the inherent gene silencing machinery which can have more than one mRNA target, whereas siRNA can be designed to target a particular mRNA target. By design, both siRNA and miRNA are 20-25 nucleotides in length. The target sequence for siRNAs is usually located within the open reading frame, between 50 and 100 nucleotides downstream of the start codon. There are two ways in which cells can be transfected with desired RNAi: 1. Direct transfection (with calcium phosphate co-precipitation or cationic lipid mediated transfection using lipofectamine or oligofectamine), and 2. Making RNAi lentiviral constructs (followed by transformation and transduction). Lentiviral constructs are time consuming, but provide a more permanent expression of RNAi in the cells, and consistent gene silencing. Direct transfection of oligonucleotides provides temporary genetic suppression. Traditional methods like calcium phosphate co-precipitation have challenges like low efficiency, poor reproducibility and cell toxicity. Whereas, cationic lipid-based transfection reagents are able to overcome these challenges, along with applicability to a large variety of eukaryotic cell lines. When using oligos, the ideal concentration lies between 10-50nM for effective transfection.

1 Matching solution
Start a discussion

Start discussion

No discussions found

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Found 1 matching solution for this experiment

Rn_Pdcd8_1 FlexiTube siRNA

Qiagen

Upstream tips	Protocol tips	Downstream tips
	The H9c2 cell line was purchased from American Tissue Type Collection (Manassas, VA; Catalog # CRL – 1446). Cells were cultured in DMEM medium supplemented with 1.5 g/l sodium bicarbonate, 10% fetal bovine serum, 100 U/ml of penicillin and 100 μg/ml of streptomycin in 150 cm2 tissue culture flasks at 37 °C in a humidified atmosphere of 5% CO2. Cells were treated with 0.5 and 1 μM DOX for 6, 24 or 48 h, according to the assay.In the day prior to transfection, cells were plated in 60 mm-diameter plates at a density of 35,000 cells/ml in DMEM. Cells were approximately 60% confluent prior to transfection. On the day of transfection, cells were incubated with AIF small interfering RNA (siRNA) (Qiagen, catalog number SI03025379/Rn_Pdcd8_1, sequence: TTGGGTCGAAGGAGAGTAGAA), with On TargetPlus scrambled negative control (OT4, scrambled RNA) (Dharmacon, catalog number #11811994, sequence: UGGUUUACAUGUUUUCCUA) or with RNA buffer solution (negative control). In one tube, 6.7 μl/plate of siRNA against AIF mRNA or OT4 mRNA were diluted in Opti-MEM and siRNA buffer solution; in a separate tube, 6 μl/plate of Lipofectamine was diluted in 500 μl/plate of Opti-MEM. Both tubes were incubated for 5 min at room temperature, following which the two tubes (siRNA AIF with Lipofectamine or siRNA OT4 with Lipofectamine) were mixed together and incubated for another 20 min at room temperature to allow for the formation of transfection complexes. Plates were washed three times with PBS and filled with 1.5 ml of Opti-MEM. One milliliter aliquot of the solution was then added to each plate and gently mixed to ensure uniform distribution. The plates were then incubated at 37 °C humidified atmosphere containing 5% CO2 and 95% air for 5 h. Following this incubation, 2.5 ml of DMEM was added. The media were again changed to fresh DMEM after 24 h and cells were treated with DOX for the required experimental protocol.

Protocol tips
The H9c2 cell line was purchased from American Tissue Type Collection (Manassas, VA; Catalog # CRL – 1446). Cells were cultured in DMEM medium supplemented with 1.5 g/l sodium bicarbonate, 10% fetal bovine serum, 100 U/ml of penicillin and 100 μg/ml of streptomycin in 150 cm2 tissue culture flasks at 37 °C in a humidified atmosphere of 5% CO2. Cells were treated with 0.5 and 1 μM DOX for 6, 24 or 48 h, according to the assay.In the day prior to transfection, cells were plated in 60 mm-diameter plates at a density of 35,000 cells/ml in DMEM. Cells were approximately 60% confluent prior to transfection. On the day of transfection, cells were incubated with AIF small interfering RNA (siRNA) (Qiagen, catalog number SI03025379/Rn_Pdcd8_1, sequence: TTGGGTCGAAGGAGAGTAGAA), with On TargetPlus scrambled negative control (OT4, scrambled RNA) (Dharmacon, catalog number #11811994, sequence: UGGUUUACAUGUUUUCCUA) or with RNA buffer solution (negative control). In one tube, 6.7 μl/plate of siRNA against AIF mRNA or OT4 mRNA were diluted in Opti-MEM and siRNA buffer solution; in a separate tube, 6 μl/plate of Lipofectamine was diluted in 500 μl/plate of Opti-MEM. Both tubes were incubated for 5 min at room temperature, following which the two tubes (siRNA AIF with Lipofectamine or siRNA OT4 with Lipofectamine) were mixed together and incubated for another 20 min at room temperature to allow for the formation of transfection complexes. Plates were washed three times with PBS and filled with 1.5 ml of Opti-MEM. One milliliter aliquot of the solution was then added to each plate and gently mixed to ensure uniform distribution. The plates were then incubated at 37 °C humidified atmosphere containing 5% CO2 and 95% air for 5 h. Following this incubation, 2.5 ml of DMEM was added. The media were again changed to fresh DMEM after 24 h and cells were treated with DOX for the required experimental protocol.

Protocol tips

The H9c2 cell line was purchased from American Tissue Type Collection (Manassas, VA; Catalog # CRL – 1446). Cells were cultured in DMEM medium supplemented with 1.5 g/l sodium bicarbonate, 10% fetal bovine serum, 100 U/ml of penicillin and 100 μg/ml of streptomycin in 150 cm2 tissue culture flasks at 37 °C in a humidified atmosphere of 5% CO2. Cells were treated with 0.5 and 1 μM DOX for 6, 24 or 48 h, according to the assay.In the day prior to transfection, cells were plated in 60 mm-diameter plates at a density of 35,000 cells/ml in DMEM. Cells were approximately 60% confluent prior to transfection. On the day of transfection, cells were incubated with AIF small interfering RNA (siRNA) (Qiagen, catalog number SI03025379/Rn_Pdcd8_1, sequence: TTGGGTCGAAGGAGAGTAGAA), with On TargetPlus scrambled negative control (OT4, scrambled RNA) (Dharmacon, catalog number #11811994, sequence: UGGUUUACAUGUUUUCCUA) or with RNA buffer solution (negative control). In one tube, 6.7 μl/plate of siRNA against AIF mRNA or OT4 mRNA were diluted in Opti-MEM and siRNA buffer solution; in a separate tube, 6 μl/plate of Lipofectamine was diluted in 500 μl/plate of Opti-MEM. Both tubes were incubated for 5 min at room temperature, following which the two tubes (siRNA AIF with Lipofectamine or siRNA OT4 with Lipofectamine) were mixed together and incubated for another 20 min at room temperature to allow for the formation of transfection complexes. Plates were washed three times with PBS and filled with 1.5 ml of Opti-MEM. One milliliter aliquot of the solution was then added to each plate and gently mixed to ensure uniform distribution. The plates were then incubated at 37 °C humidified atmosphere containing 5% CO2 and 95% air for 5 h. Following this incubation, 2.5 ml of DMEM was added. The media were again changed to fresh DMEM after 24 h and cells were treated with DOX for the required experimental protocol.

Manufacturer protocol Publication protocol 1 Relevant paper

Can't find the product you've used to perform this experiment? It would be great if you can help us by Adding a product!

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

Outsource experiment