No discussions found
Start your discussion
Share your thoughts or question with experts in your field
Start a discussion
Found 1 matching solution for this experiment
HuR siRNA + Lipofectamine® 2000 Transfection Reagent
| Upstream tips |
Protocol tips |
Downstream tips |
|
siRNA sequence: 5′AACACGCTGAACGGCTTGAGG
siRNA concentratin:Mix 20-mM stock duplex siHuR with 300 μl of Opti-MEM medium.
Incubate for 20 min at room temperature and gently add to cells.
Incubate cells for 48 h at 37°C |
|
| Protocol tips |
siRNA sequence: 5′AACACGCTGAACGGCTTGAGG
siRNA concentratin:Mix 20-mM stock duplex siHuR with 300 μl of Opti-MEM medium.
Incubate for 20 min at room temperature and gently add to cells.
Incubate cells for 48 h at 37°C |
Can't find the product you've used to perform this experiment? It would be great if you can help us by
Adding a product!