QuikChange Site-Directed Mutagenesis Kit, 10 Rxn

Protocol tips

Upstream tips	Protocol tips	Downstream tips
- XL10-Gold cells are resistant to tetracycline and chloramphenicol. If the mutagenized plasmid contains only the tetR or camR resistance marker, an alternative strain of competent cells must be used.	- Use only the Dpn I enzyme provided; do not substitute with an enzyme from another source.

Upstream tips
- XL10-Gold cells are resistant to tetracycline and chloramphenicol. If the mutagenized plasmid contains only the tetR or camR resistance marker, an alternative strain of competent cells must be used.
Protocol tips
- Use only the Dpn I enzyme provided; do not substitute with an enzyme from another source.

Publication protocol

Construction of “knobs-into-holes” CH3 variants
The humanized trastuzumab heavy chain variable region and light chain [DrugBank: trastuzumab (DB00072) (BIOD00098, BTD00098)] genes were synthesized and cloned into the mammalian expression plasmid pDR12 containing human immunoglobulin G (IgG)-1 heavy chain genomic DNA constant regions. Two mutations were introduced in the CH3 domains of pDR12-trastuzumab (T366Y) and pDR12-m590 (Y407T) using a site-directed mutagenesis kit (Stratagene). The primers for the mutagenesis were: T366Y-F: 5′-CCAGGTCAGCCTGTACTGCCTGGTCAAAG-3′, and T366Y-R: 5′- CTTTGACCAGGCAGTACAGGCTGACCTGG-3′; and Y407T-F: 5′-CTCCTTCTTCCTCACCAGCAAGCTCACCG-3′, and Y407T-R: 5′- CGGTGAGCTTGCTGGTGAGGAAGAAGGAG -3′. The mutations were confirmed by DNA sequencing. The resultant plasmids were designated as pDR12-trastuzumab-366 and pDR12-m590-407, respectively.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation SKOV3 humanized trastuzumab using QuikChange Site-Directed Mutagenesis Kit, 10 Rxn from Agilent Technologies.

Manufacturer protocol

Download the product protocol from Agilent Technologies for QuikChange Site-Directed Mutagenesis Kit, 10 Rxn below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation SKOV3 humanized trastuzumab using QuikChange Site-Directed Mutagenesis Kit, 10 Rxn from Agilent Technologies. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.