Q5® Site-Directed Mutagenesis Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	- Only use 1 μl of PCR product in the KLD reaction. Carrying too much PCR product forward can decrease transformation efficiency. - Only use 5 μl of the KLD reaction in the transformation. If more KLD reaction is added, a buffer exchange step, such as PCR purification, should be included prior to transformation.

Protocol tips
- Only use 1 μl of PCR product in the KLD reaction. Carrying too much PCR product forward can decrease transformation efficiency. - Only use 5 μl of the KLD reaction in the transformation. If more KLD reaction is added, a buffer exchange step, such as PCR purification, should be included prior to transformation.

Publication protocol

siRNA Transfection and gene transfer
All Zdhhc and PLCβ1 siRNA were purchased from Santa Cruz Biotech. pCMV6 empty vector, and ZDHHC21 plasmids were purchased from Origene; and pLX304 empty vector and PLCβ1 plasmids were purchased from Genecopoeia. MLMVECs grown to 90% confluence were trypsinized, pelleted, and resuspended in 100 μl of P5 Primary Cell 4D-NucleofectorTM X with 1 μM siRNA or 2 μg plasmid. Cells were rapidly electroporated using the 4D-NucleofectorTM System (Lonza, MD, USA) and plated in Endothelial cell complete medium (Cell Biologics) for experiments. Mutation at potential palmitoylation site of PLCβ1 was created by mutagenesis using as template the pLX304 with PLCβ1 transcript variant 1 cDNA clone purchased from Genecopoeia; and the Q5 Site-Directed Mutagenesis Kit with supplied 5-alpha competent cells purchased from New England BioLabs. PLCβ1 C17S mutagenesis primers (Fw: 5′ AAGCCCGTGTCCGTGTCCGAC 3′; Rev: 5′ GAGTTGCAAGGCGTGCAC 3′) were designed using the NEBaseChanger tool also provided by New England BioLabs. Successful mutation of C17S was confirmed by sequencing using (Fw: 5′ ACATCAATGGGCGTGGATAG 3′; Rev 5′ GGAAAGCCACGAGATTCAAATG 3′) designed with the PrimerQuest tool provided by Integrated DNA Technologies and Sanger sequencing of PCR product provided by Genewiz.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation HUVEC PLCb1 using Q5® Site-Directed Mutagenesis Kit from New England BioLabs.

Manufacturer protocol

Download the product protocol from New England BioLabs for Q5® Site-Directed Mutagenesis Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation HUVEC PLCb1 using Q5® Site-Directed Mutagenesis Kit from New England BioLabs. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.