GeneArt™ Site-Directed Mutagenesis System

Protocol tips

Upstream tips	Protocol tips	Downstream tips
- Use 20–25 ng of the target plasmid per 50 µL of mutagenesis reaction as a starting point.	- Create a fresh dilution of 25X SAM from the kit-supplied 200X SAM in sterile, distilled water each time you perform the mutagenesis procedure - 25X SAM is not stable, and loses activity within a few hours after preparation

Upstream tips
- Use 20–25 ng of the target plasmid per 50 µL of mutagenesis reaction as a starting point.
Protocol tips
- Create a fresh dilution of 25X SAM from the kit-supplied 200X SAM in sterile, distilled water each time you perform the mutagenesis procedure - 25X SAM is not stable, and loses activity within a few hours after preparation

Publication protocol

Plasmids.
pCDNA-3 FLAG-tagged MAGI-1 has been described previously (20). The K499E MAGI-1 mutant was generated using the GeneArt site-directed mutagenesis system (Invitrogen) according to the manufacturer's instruction, using the following primers: forward primer 5′TCCTGCAGATCGAAAGCCTCGTCCTCGATGGTCCT and reverse primer 5′ACGAGGCTTTCGATCTGCAGGAACTCATCAGGCTC.

Untagged HPV-18 E6 and HPV-16 E6 pCDNA-3 expression plasmids have been described previously (18, 36), as have the glutathione transferase (GST) fusion proteins HPV-18 E6 and HPV-16 E6 (37). pCMV MYC-tagged NET1 was described previously (38), and hemagglutinin (HA)-tagged β-catenin was kindly given by Claudio Brancolini.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation H1299 MAGI-1 using GeneArt™ Site-Directed Mutagenesis System from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for GeneArt™ Site-Directed Mutagenesis System below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation H1299 MAGI-1 using GeneArt™ Site-Directed Mutagenesis System from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.