GeneArt™ Site-Directed Mutagenesis System

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	- Create a fresh dilution of 25X SAM from the kit-supplied 200X SAM in sterile, distilled water each time you perform the mutagenesis procedure - 25X SAM is not stable, and loses activity within a few hours after preparation

Protocol tips
- Create a fresh dilution of 25X SAM from the kit-supplied 200X SAM in sterile, distilled water each time you perform the mutagenesis procedure - 25X SAM is not stable, and loses activity within a few hours after preparation

Publication protocol

2.4. Site-directed mutagenesis
PCNA mutant plasmids were generated from T7-PCNA or pEGFP-PCNA expression vectors using a GeneArt Site-Directed Mutagenesis System according to the manufacturer’s instructions. A M40A mutant template was generated using the oligonucleotides 5′ GTGTAAACCTGCAGAGCGCAGACTCGTCCCACGTCTC and 5′ GAGACGTGGGACGAGTCTGCGCTCTGCAGGTTTACAC, while a H44A mutant template was produced using the oligonucleotides 5′ GAGCATGGACTCGTCCGCAGTCTCTTTGGTGCAG and 5′ CTGCACCAAAGAGACTGCGGACGAGTCCATGCTC. A M40A/H44A double PCNA mutant was also generated from the M40A template using oligonucleotides 5′ GTGTAAACCTGCAGAGCGCAGACTCGTCCGCAGTCTC and 5′ GAGACTGCGGACGAGTCTGCGCTCTGCAGGTTTACAC. The sequences of mutated plasmids were subsequently validated by Sanger DNA sequencing performed by the Hartwell Center. Recombinant PCNA proteins were prepared as described previously 6.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation U2OS PCNA using GeneArt™ Site-Directed Mutagenesis System from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for GeneArt™ Site-Directed Mutagenesis System below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation U2OS PCNA using GeneArt™ Site-Directed Mutagenesis System from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.