Q5® Site-Directed Mutagenesis Kit

Site Directed Mutagenesis (SDM) Human - Point mutation DUCaP MLPH

Experiment
Site Directed Mutagenesis (SDM) Human - Point mutation DUCaP MLPH
Product
Q5® Site-Directed Mutagenesis Kit from New England BioLabs
Manufacturer
New England BioLabs

Protocol tips

Protocol tips
- Only use 1 μl of PCR product in the KLD reaction. Carrying too much PCR product forward can decrease transformation efficiency.

- Only use 5 μl of the KLD reaction in the transformation. If more KLD reaction is added, a buffer exchange step, such as PCR
purification, should be included prior to transformation.

Publication protocol

Reporter Vector Construction and Site‐Directed Mutagenesis
Firefly luciferase reporter vectors harboring the ARBS of the MLPH gene, with the major T allele of SNP rs11891426:T>G, were constructed according to the procedures previously described [Bu et al., 2013]. Briefly, the MLPH ARBS was PCR amplified using primers F: 5′‐ TATCCAACACACGGGCTGAT ‐3′ and R: 5′‐ AGCTTTGGGGATTTCATTTCA ‐3′, purified and first ligated to the PCR fragment cloning vector PSC‐B (Agilent Technologies, Santa Clara, CA), and then inserted into the KpnI/SacI sites of the PGL3 promoter luciferase reporter plasmid (Promega, Madison, WI). The minor G allele counterpart of the reporter vector or mutations of the two putative androgen‐responsive elements (AREs) were generated using the QuikChange II site‐directed (Agilent) or the Q5 site‐directed mutagenesis (NEB, Ipswich, MA) kits. Primers used for mutagenesis were 5′‐CAGCTCCCTGCTGCCAGCCTGGGG for G allele alteration, 5‐GCTTCCAGCCTGGGGTGCGTTCTGCACGCCTCCCTGAAATG for mutation of AR binding motif 3 and 5′‐GCCAGCCCACAGCGTTCTGCACGCAGCCTGGGGTGGGAC for mutation of AR‐binding motif 2.

Full paper   Login or join for free to view the full paper.

Reviews

Q5® Site-Directed Mutagenesis Kit from New England BioLabs has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation DUCaP MLPH using Q5® Site-Directed Mutagenesis Kit from New England BioLabs.

Paper title
Putative Prostate Cancer Risk SNP in an Androgen Receptor‐Binding Site of the Melanophilin Gene Illustrates Enrichment of Risk SNPs in Androgen Receptor Target Sites
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from New England BioLabs for Q5® Site-Directed Mutagenesis Kit below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation DUCaP MLPH using Q5® Site-Directed Mutagenesis Kit from New England BioLabs. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Become shareholder Discussions About us Contact Privacy Terms