Phusion Site-Directed Mutagenesis Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Phusion Hot Start II DNA Polymerase tends to work better at elevated denaturation and annealing temperatures due to higher salt concentrations in its buffer. Hence follow manufacturer instruction strictly.

Upstream tips
Phusion Hot Start II DNA Polymerase tends to work better at elevated denaturation and annealing temperatures due to higher salt concentrations in its buffer. Hence follow manufacturer instruction strictly.

Publication protocol

ISG15 overexpression assays.
Total RNA from A549 RSV-infected cells was reverse transcribed with the High-Capacity cDNA Archive kit using an oligo(dT) primer (Applied Biosystems), and ISG15 was amplified using the following primers: forward, (5′AAAAGCGGCCGCGGTGCTGCCTGCCGAAG3′), and reverse, (5′AAAAGCGGCCGCTCTTTACAACAGCCTTTATTTCCG3′). The PCR product was cloned into the mammalian vector pCMV6-Neo (Origene), and the resulting plasmid, pCMV6-Neo-ISG15, was sequenced in order to verify that the ISG15 sequence was correct. Synthesis of the nonconjugative ISG15 plasmid pCMV6-Neo-ISG15-LRAA from pCMV6-Neo-ISG15 was performed by directed mutagenesis using the Phusion site-directed mutagenesis kit (Thermo Scientific), following the manufacturer′s instructions, with the following primers: forward, (5′CCTGCGGGCAGCCGGCACAGAGCCTGGCGGGCGGAGC3′), and reverse, (5′GGCTGCCCGCAGGCGCAGATTCATGAACACGGT3′).

For overexpression assays, 5 × 104 A549 cells were plated in each well of a 12-well plate and incubated for 60 h before transfection. The cells were then transfected with 1 μg of purified plasmid (EndoFree Plasmid Maxi kit; Qiagen) and 4 μl of Lipofectamine 2000 (Invitrogen) per well. Twenty-four hours after transfection, the cells were infected with RSV at an MOI of 3. Cell supernatants for viral titration and cell pellets for RNA and protein extraction were collected at different times postinfection.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation A549 ISG15 using Phusion Site-Directed Mutagenesis Kit from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for Phusion Site-Directed Mutagenesis Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Human - Point mutation A549 ISG15 using Phusion Site-Directed Mutagenesis Kit from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.