Q5® Site-Directed Mutagenesis Kit

Site Directed Mutagenesis (SDM) Mouse - Point mutation C2C12 miR-145

Experiment
Site Directed Mutagenesis (SDM) Mouse - Point mutation C2C12 miR-145
Product
Q5® Site-Directed Mutagenesis Kit from New England BioLabs
Manufacturer
New England BioLabs

Protocol tips

Protocol tips
- Only use 1 μl of PCR product in the KLD reaction. Carrying too much PCR product forward can decrease transformation efficiency.

- Only use 5 μl of the KLD reaction in the transformation. If more KLD reaction is added, a buffer exchange step, such as PCR
purification, should be included prior to transformation.

Publication protocol

Luciferase reporter assays
The 3’UTR of mouse Cited2 (accession NM_010828.3, nucleotides 1051–1853) was amplified from mouse genomic DNA with Platinum Pfx DNA polymerase (Life Technology) and cloned into the pmirGLOW Dual Luciferase vector (Promega) downstream from the luciferase gene. The resulting constructs were sequenced to confirm their identity.

To modify the miR-145 target site in the Cited2-3’UTR, the plasmid was subjected to site directed mutagenesis using the Q5 Site directed mutagenesis kit (New England Biolabs) and the appropriate mutagenic primers (5’AATATGCTAACAGAGAAGATTAAACATGTGGGCCAAAC and 5’TGAAAACTTAAGTCTGTACTC). The miR-145 target site was changed from AACUGGAA to ACAGAGAA. The presence of the mutation was verified by sequencing.

Full paper   Login or join for free to view the full paper.

Reviews

Q5® Site-Directed Mutagenesis Kit from New England BioLabs has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Mouse - Point mutation C2C12 miR-145 using Q5® Site-Directed Mutagenesis Kit from New England BioLabs.

Paper title
The Signature of MicroRNA Dysregulation in Muscle Paralyzed by Spinal Cord Injury Includes Downregulation of MicroRNAs that Target Myostatin Signaling
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from New England BioLabs for Q5® Site-Directed Mutagenesis Kit below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Mouse - Point mutation C2C12 miR-145 using Q5® Site-Directed Mutagenesis Kit from New England BioLabs. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms