GeneArt™ Site-Directed Mutagenesis System

Protocol tips

Upstream tips	Protocol tips	Downstream tips
- Use 20–25 ng of the target plasmid per 50 µL of mutagenesis reaction as a starting point.	- Create a fresh dilution of 25X SAM from the kit-supplied 200X SAM in sterile, distilled water each time you perform the mutagenesis procedure - 25X SAM is not stable, and loses activity within a few hours after preparation

Upstream tips
- Use 20–25 ng of the target plasmid per 50 µL of mutagenesis reaction as a starting point.
Protocol tips
- Create a fresh dilution of 25X SAM from the kit-supplied 200X SAM in sterile, distilled water each time you perform the mutagenesis procedure - 25X SAM is not stable, and loses activity within a few hours after preparation

Publication protocol

Luciferase assays
Mouse promoter, as shown in , was cloned into a luciferase-pcDNA3 plasmid upstream of the luciferase gene. The promoter/luciferase plasmid was mutated using the GeneArt Site-Directed Mutagenesis System (Invitrogen) at promoter E-box site (CATATG) (E3) by using two different sets of primers: Mutant 1 F: 5′- AGAGCTCATGTCTCTAGCTGCGGATGTAGCAGAA -3′, R: 5′- GCAGCTAGAGACATGAGCTCTGGGGGTACTGG -3′ and Mutant2 F: 5′- AGAGCTCATGTCTCTAGCTGCTGGTATAGCAGAAGAT -3′, R: 5′- GCAGCTAGAGACATGAGCTCTGGGGGTACTGG -3′. C2C12 cells were stably transfected with the wild-type and mutant /luciferase plasmids. Cells expressing the wild-type or mutant promoters were differentiated for 2 days before being transfected with AdT or AdC (control adenoviral vector) after which cells were differentiated for a further 2 days. Luciferase gene expression was then measured using Dual-Luciferase Reporter Assay (Promega). Cells were lysed and mixed with Luciferase Assay Substrate (LAR II) before measuring activity in a luminometer (Berthold). In order to ensure that luciferase readings reflect results originating from viable cells, the viability of cells in experiment was measured using a cell counter (Countess Automated cell counter, Invitrogen).



Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Mouse - Point mutation C2C12 myogenin using GeneArt™ Site-Directed Mutagenesis System from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for GeneArt™ Site-Directed Mutagenesis System below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Mouse - Point mutation C2C12 myogenin using GeneArt™ Site-Directed Mutagenesis System from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.