QuikChange Site-Directed Mutagenesis Kit, 10 Rxn

Protocol tips

Upstream tips	Protocol tips	Downstream tips
- XL10-Gold cells are resistant to tetracycline and chloramphenicol. If the mutagenized plasmid contains only the tetR or camR resistance marker, an alternative strain of competent cells must be used	- Use only the Dpn I enzyme provided; do not substitute with an enzyme from another source.

Upstream tips
- XL10-Gold cells are resistant to tetracycline and chloramphenicol. If the mutagenized plasmid contains only the tetR or camR resistance marker, an alternative strain of competent cells must be used
Protocol tips
- Use only the Dpn I enzyme provided; do not substitute with an enzyme from another source.

Publication protocol

Introducing point mutations into the MMP-9 reporter plasmid.
The luciferase reporter plasmid for MMP-9 containing the wild-type (wt) MMP-9 promoter fragment from bp −1369 to +35 (herein called MMP-9 luc wt) and the fragment with the proximal AP-1 binding site mutated from bp −88 to −80 [herein called MMP-9 luc mt(−88/−80)] were described previously (24). Point mutations in the core of the distal AP-1 binding site mt(−514/−507) fragment as well as in the potential SRF-binding site mt(−237/−228) fragment of the MMP-9 promoter were introduced with a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocol. The following primers were used: GCAGGAGAGGAAGCTGAGAAAAAGACACTAACAGGGGG (AP-1 binding site, TGAGTCA) and TGTGGGTCTGGGGTCCTGCTTGCCTTTTCAGTGGGGGACTGTGGGCA (SRF-binding site, CCTGACTTGG) (nucleotides corresponding to the indicated transcription factor binding site are in boldface and substituted nucleotides are underlined).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Rat - Point mutation Rat-2 MMP-9 promoter using QuikChange Site-Directed Mutagenesis Kit, 10 Rxn from Agilent Technologies.

Manufacturer protocol

Download the product protocol from Agilent Technologies for QuikChange Site-Directed Mutagenesis Kit, 10 Rxn below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Rat - Point mutation Rat-2 MMP-9 promoter using QuikChange Site-Directed Mutagenesis Kit, 10 Rxn from Agilent Technologies. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.