Q5® Site-Directed Mutagenesis Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	- Only use 1 μl of PCR product in the KLD reaction. Carrying too much PCR product forward can decrease transformation efficiency. - Only use 5 μl of the KLD reaction in the transformation. If more KLD reaction is added, a buffer exchange step, such as PCR purification, should be included prior to transformation.

Protocol tips
- Only use 1 μl of PCR product in the KLD reaction. Carrying too much PCR product forward can decrease transformation efficiency. - Only use 5 μl of the KLD reaction in the transformation. If more KLD reaction is added, a buffer exchange step, such as PCR purification, should be included prior to transformation.

Publication protocol

Plasmids and cloning of recombinant proteins
The vectors pDsRed2-ER, pmCherry-N1, and pEGFP-N3 were obtained from Clontech. pEGFP-N1 containing the coding sequence (cds) of human PLIN2 was a kind gift from Stefan Höning (Cologne, Germany). To generate a plasmid encoding PLIN2-mCherry, the cds of PLIN2 was amplified using the primers 5′-GCG AAT TCG CCA TGG CAT CCG TTG CAG TTG A-3′ and 5′-CAA CCG GTC GAT GAG TTT TAT GCT CAG ATC G-3′, and the PCR product was digested with EcoRI and AgeI and ligated into the multiple cloning site of pmCherry-N1. The cds of PNPLA7 was amplified by PCR using cDNA of murine cardiac muscle as template and the primers 5′-TTC TCG AGG CCA TGG AGG AGC AGT CCC AGT CC-3′ (F1) and 5′-GCG AAT TCG ACG AAG GAT GTT CCA GTC TTG G-3′ (R1). PNPLA7 truncation mutants were generated by PCR using the primers 5′-TTC TCG AGG CCA TGG CAG AAC CCA CTC CTC AGT AC-3′ (F2) and R1 for ΔTM-PNPLA7 (Δ1–40), 5′-TTC TCG AGG CCA TGG TTG TAA CGC GAC TGA TTC ATC TC-3′ (F3) and R1 for PNPLA7-C (Δ1–680), 5′-GCG AAT TCG CCA TGG AGG AGC AGT CCC AGT C-3′ (F4) and 5′-CAG GAT CCC CGT CGT AAT CTT CTC ACT C-3′ (R2) for TM-PNPLA7 (Δ41–1326), F1 and 5′-GCG AAT TCG ACT GTG GGT ACC TGC GCT TGA TAG-3′ (R3) for PNPLA7-N (Δ681–1326), F3 and 5′-GCG AAT TCG ATC TTG CCA CAT CCG CTG GGA G-3′ (R4) for PNPLA7-C1 (Δ1–680, Δ1091–1326), F3 and 5′-GCG AAT TCG AGA AGA TGT TGC TGA TGC TGC-3′ (R5) for PNPLA7-C2 (Δ1–680, Δ1018–1326), F3 and 5′-GCG AAT TCG AAG CAA ACA GAG CAC CCA TGA A-3′ (R6) for PNPLA7-C3 (Δ1–680, Δ968–1326), F3 and 5′-GCG AAT TCG AGG CAC ACC CTC TAG CTC CAC C-3′ (R7) for PNPLA7-C4 (Δ1–680, Δ936–1326), 5′-TTC TCG AGG CCA TGT TTG CTC TGG AGC TCC AAC A-3′ (F4) and R1 for PNPLA7-C5 (Δ1–741), 5′-TTC TCG AGG CCA TGT TGG TGC TTG GAG GGG GTG GA-3′ (F5) and R1 for PNPLA7-C6 (Δ1–923), 5′-TTC TCG AGG CCA TGT CCA TGG GGG CAA AGG TTG TG-3′ (F6) and R1 for PNPLA7-C7 (Δ1–1090), and F4 and R6 for PNPLA7-C8 (Δ1–741, Δ968–1326). The PCR products were purified by agarose gel electrophoresis and inserted into the multiple cloning site of pEGFP-N3 using the XhoI and EcoRI restriction sites to create C-terminal in-frame fusions with EGFP. Internal deletion mutants of PNPLA7 were generated using the Q5® site-directed mutagenesis kit with PNPLA7-EGFP as template and the primers 5′-CCG TCG TAA TCT TCT CAC-3′ and 5′-GTT GTA ACG CGA CTG ATT C-3′ for ΔR-PNPLA7 (Δ41–680), 5′-CAG ATC ATC ATG GTC CGG-3′ and 5′-CCG AAC ATT TTT CAA CAT GTA C-3′ for ΔCBD1 (Δ144–265), 5′-GTC CTG GGC GTG GCA CAC-3′ and 5′-GTC CTT TGT GGC AGC TCT GAA G-3′ for ΔCBD2 (Δ455–565), and 5′-GTT GTA ACG CGA CTG ATT C-3′ and 5′-CAT CCT CTT CAC AAC TGT G-3′ for ΔCBD3 (Δ578–680). A DNA fragment encoding for PNPLA7 harboring an N-terminal HA tag was created by PCR using the primers 5′-TAA TCT CGA GGC CAC CAT GTA CCC ATA CGA TGT TCC AGA TTA CGC TAT GGA GGA GCA GTC CCA GTC-3′ and 5′-GAC GAA TTC GTC AGG AAG GAT GTT CCA GTC-3′. The PCR product was purified as described above and inserted into the multiple cloning site of pEGFP-N3 using the XhoI and EcoRI restriction sites. To generate lentiviral expression vectors, pEGFP-N3 constructs encoding the open reading frames for EGFP, PNPLA7-EGFP, and PNPLA7-C-EGFP were digested with XhoI and NotI, and the resulting fragments were inserted into the multiple cloning site of pLVX IRES Puro (Clontech). Mission® lentiviral pLKO.1 vectors encoding for scrambled shRNA or shRNAs targeting murine PNPLA7 were obtained from Sigma-Aldrich. Constructs used for RNAi experiments targeted the sequences CCAAGAGGATTCTGCGCTTTA (shRNA1) and CATGTCCTTGTCAGGCTATAT (shRNA2) of the PNPLA7 cds.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Monkey - Deletion COS-7 PNPLA7 using Q5® Site-Directed Mutagenesis Kit from New England BioLabs.

Manufacturer protocol

Download the product protocol from New England BioLabs for Q5® Site-Directed Mutagenesis Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Monkey - Deletion COS-7 PNPLA7 using Q5® Site-Directed Mutagenesis Kit from New England BioLabs. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.