Cas9 sgRNA vector

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Generation of Y537S CRISPR knock-in cell lines
MCF7 cells were transfected with a sgRNA CAS9 vector and a donor cassette as a non-digested plasmid at a 2:1 ratio using Fugene (Promega). The gRNA sequence used was ctccagcagcaggtcataga. The donor cassette contained a 800bp and 1kb homology regions for incorporation of the Y537S mutation via homologous directed repair (HDR). Between the homology regions, a Neomycin resistance gene was encoded, which was under the PKG promotor and used for selection of HDR events 48 hours post transfection. After two weeks of selection, single cell clones were generated and screened with ddPCR for evidence of Y537S mutation. The digital droplet PCR was performed (24) using ddPCR primers (cgggttggctctaaagtagt and aatgcgatgaagtagagccc) and specific probes (BHQ_cc{C}ctc{tAt}gacc{t}g_HEX and BHQ_CC{A}CTC{TCT}GAC{C}TG_FAM). The location of the insertion was confirmed using junction PCR with the following primer pairs,

1 (TTAGATCATGCTGTAGGCCCTG) + 2 (CTGGAACCCATGACCGGAAAG),

3 (GCAGATCCAGGGGGCATTTA) + 4 (GATGTGGAATGTGTGCGAGC),

2 (CTGGAACCCATGACCGGAAAG) 5 (GGATCAATTCTCTAGAGCTCGC).

Tide analysis (25) was used to confirm the frame shift mutation of the 2nd ESR1 allele. Targeted locus amplification (TLA) sequencing (26) confirmed the genotype of the 3 ESR1 alleles (A2942C (Y537S) knock-in, inactivating single base insertion knock-out and inactivating 48bp deletion).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Activation ESR1 using Cas9 sgRNA vector from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for Cas9 sgRNA vector below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Activation ESR1 using Cas9 sgRNA vector from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.