iScript™ Reverse Transcription Supermix for RT-qPCR

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Prepare transfection master mix and mix throughly by pippetting. Add 15ul master mix to 5ul of RNA for each RT reaction. Adjust the volume of water if the input of RNA is not to 5 ul input (1ug-1pg)

Protocol tips
Prepare transfection master mix and mix throughly by pippetting. Add 15ul master mix to 5ul of RNA for each RT reaction. Adjust the volume of water if the input of RNA is not to 5 ul input (1ug-1pg)

Publication protocol

We measured relative RNAp concentrations in cells using four different methods. First, relative RNAp concentrations in the strains W3110 and DH5α-PRO were measured from the relative rpoC transcript levels obtained using RT-PCR. Cells containing the target plasmid with Plac/ara-1-mRFP1-96BS and the reporter plasmids were grown overnight in respective media. Cells were diluted into fresh media to an OD600 of 0.05. After 110 min, cells were re-diluted to an OD600 of 0.05 into respective media containing IPTG (1 mM) and arabinose (1%). After 70 min, RNA protect reagent was added to fix the cells, followed by enzymatic lysis with Tris–EDTA lysozyme buffer (pH 8.3). RNA was isolated from cells using RNeasy mini-kit (Qiagen). One microgram of RNA was used as the starting material. The RNA samples were treated with DNase free of RNase to remove residual DNA. Next, RNA was reverse transcribed into cDNA using iSCRIPT reverse transcription super mix (Biorad). RT-PCR was performed using Power SYBR-green master mix (Life Technologies) with primers for the amplification of the target gene at a concentration of 200 nM. Reactions were carried out in triplicate with 500 nM per primer with a total reaction volume 20 µl. The following primers were used for quantification: RpoC-F: CGTCAGATGCTGCGTAAAGC, RpoC-R: GCGATCTTGACGCGAGAGTA, mRFP1-F: TACGACGCCGAGGTCAAG, mRFP1-R: TTGTGGGAGGTGATGTCCA. Estimated relative RNAp concentrations Rˆm in each condition m, and their standard uncertainties σ(Rˆm), were calculated according to the ΔC'T method.36

Second, E. coli RL1314 cells with fluorescently tagged β′ subunits were grown overnight in respective media. A pre-culture was prepared by diluting cells to an OD600 of 0.1 with fresh specific medium, and grown to an OD600 of 0.5 at 37°C at 250 rpm. Cells were pelleted by centrifugation and re-suspended in saline. Fluorescence from the cell population was measured using a fluorescent plate-reader (Thermo Scientific Fluoroskan Ascent Microplate Fluorometer).

Third, relative RNAp concentrations were also estimated based on the growth rates of DH5α-PRO cells in Supplementary Fig. S1. First, we fit a power law function to the ‘RNA polymerase molecules per cell’ row of Table ​Table33 from ref. 32, which we found to be R=106µ−1.426, where µ is the cell doubling time. Relative RNAp concentrations were then estimated from the measured cell doubling times.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing cDNA synthesis Bacteria using iScript™ Reverse Transcription Supermix for RT-qPCR from Bio-Rad Laboratories.

Manufacturer protocol

Download the product protocol from Bio-Rad Laboratories for iScript™ Reverse Transcription Supermix for RT-qPCR below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing cDNA synthesis Bacteria using iScript™ Reverse Transcription Supermix for RT-qPCR from Bio-Rad Laboratories. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.