RNeasy Plus Mini Kit

RNA isolation / purification Cells - primary mouse oocytes

Experiment
RNA isolation / purification Cells - primary mouse oocytes
Product
RNeasy Plus Mini Kit from Qiagen
Manufacturer
Qiagen

Protocol tips

Downstream tips
- Include DNAse treatment for 15-20min.

- Ensure EtOH is completely evaporated off of the column prior to elution. Adjust time from 1min to 5 min at 60`C.

- Use water to elute the RNA that is warmed to ~60`C.

Publication protocol

Total RNAs were extracted from GV, MI or MII oocytes using the RNeasy Plus Mini Kit (Qiagen) followed by reverse transcription (RT) using Sensiscript RT kit (Qiagen). PCR was performed using the following primers: for Cdc25B, GATGGAAGTAGAGGAGC and CTTCCAGGGGTGTCACAC; for GAPDH, ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA. PCR conditions were as follows: denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 sec, extension at 72°C for 30 s, and final extension at 72°C for 10 min.



Full paper   Login or join for free to view the full paper.

Reviews

RNeasy Plus Mini Kit from Qiagen has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

1 year ago

Author: Switzerland

I am having trouble using the QiageN RNAeasy mini kit for CD34+ cells. Any tips?

I am having trouble using the QiageN RNAeasy mini kit for CD34+ cells. Any tips?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - primary mouse oocytes using RNeasy Plus Mini Kit from Qiagen.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Qiagen for RNeasy Plus Mini Kit below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - primary mouse oocytes using RNeasy Plus Mini Kit from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Become shareholder Discussions About us Contact Privacy Terms