cDNA SynthePrimeScript™ 1st strand ssynthesis Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
THis kit can be used to synthesize first strand cDNA from total or polyA RNA. Highly sensitive: use less of your precious RNA samples	Heat at 65°C for 5 min, then immediately cool on ice

Upstream tips
THis kit can be used to synthesize first strand cDNA from total or polyA RNA. Highly sensitive: use less of your precious RNA samples
Protocol tips
Heat at 65°C for 5 min, then immediately cool on ice

Publication protocol

SNU484 and HeLa cells were maintained in RPMI and DMEM, respectively, containing 10% fetal bovine serum with 100 unit/ml penicillin/streptomycin at 37 °C in 5% CO2 atmosphere. Transfection were performed with pCS4 vector or pCS4-Myc-Prx1 plasmid using Lipofectamine 2000 according to the manufacturer's protocol (Invitrogen). The cells were synchronized at G0/G1 stage by serum starvation for 72 h and then exposed to 5 μg/ml ActD for indicated times with complete growth medium [2]. Total RNA was extract with TRIzol reagent at the indicated time points following the addition of ActD to block the synthesis of new transcripts. The cDNA was synthesized from 1 μg of total RNA by reverse-transcription PCR with a PrimeScript 1st Strand cDNA Synthesis Kit (Takara). Quantitative real-time PCR using SYBR Premix Ex Taq II was performed to compare the rate of RNA decay in the vector-transfected and Prx1-transfected cells. The human cyclophilin was used as control for mRNA normalization and U6 was used as control for snRNA normalization. The RNA levels were expressed relative to before ActD treatment. Primers used for this analysis are follows: RNU1-7, forward 5′ TGATCACGAAGGTGGTTTTCC 3′ and reverse 5′ GCACATCCGGAGTGCAATC 3’; RNU4-2, forward 5′ GCGCGATTATTGCTAATTGAAAA 3′ and reverse 5′ GCCAATGCCGACTATATTTCAAG 3’; HIST1H4J, forward 5′ ATGTCTGGCCGCGGCAAAGGC 3′ and reverse 5′ GCCGGCTTGGTGATGCCCTGG 3’; ATP5I, forward 5′ ATGGTGCCACCGGTGCAGGT 3′ and reverse 5′ TTAGGTAATTGTAGCGCGTGGC 3’; U6, forward 5′ GCTTCGGCAGCACATATACTAAAAT 3′ and reverse 5′ CGCTTCACGAATTTGCGTGTCAT 3’; Cyclophilin, forward 5′

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing cDNA synthesis Cell lines using cDNA SynthePrimeScript™ 1st strand ssynthesis Kit from Takara Bio Inc.

Manufacturer protocol

Download the product protocol from Takara Bio Inc for cDNA SynthePrimeScript™ 1st strand ssynthesis Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing cDNA synthesis Cell lines using cDNA SynthePrimeScript™ 1st strand ssynthesis Kit from Takara Bio Inc. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.