Lipofectamine® RNAiMAX Transfection Reagent

siRNA / RNAi /miRNA transfection Human Cells - THP-1 Lipofectamine

Experiment
siRNA / RNAi /miRNA transfection Human Cells - THP-1 Lipofectamine
Product
Lipofectamine® RNAiMAX Transfection Reagent from Thermo Fisher Scientific
Manufacturer
Thermo Fisher Scientific

Protocol tips

Protocol tips
Add diluted siRNA to diluted Lipofectamine® RNAiMAX Reagent (1:1 ratio). 

Incubate for 5 minutes at room temperature and add to cells. 

Incubate cells for 1 day at 37°C. 

Publication protocol

The cells were placed in serum-free complete medium 30 min prior to transfection. siRNAs against lectin-like oxLDL receptor-1 (LOX-1; GTA TATGCTAATTGCTTTTA), macrophage scavenger receptor class A (SRA; CTAGAATTTGTATTGCTACA), CD36 (GCTGAGAATAAGCAGCAATA), c-jun (CCTGGCAAA TCAACAAGGTA), p65 (CCTTCTGCCTCCCAGGTTCA) (all from Baiao Biotech Products Corp., Tianjin, China) or miR-146a mimic/mimic-control or miR-146a inhibitors/inhibitor control (Ruibo Biotech Products Co., Guangzhou, China) were transfected using the Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific, Inc.) following the manufacturer's recommendations. A total of 2 µl siRNA at a
final concentration of 50 nM or 2 µg plasmids, were mixed with 3.3 µl transfection reagent in RNase-free tubes containing 200 µl serum-free medium. After 15 min, the mixture was added into the cell culture plate, and following 24 h the cells were harvested.

Full paper   Login or join for free to view the full paper.

Reviews

Lipofectamine® RNAiMAX Transfection Reagent from Thermo Fisher Scientific has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

4 years ago

Author: Keith L. Morrison Canada

siRNA/RNAi/miRNA transfection human

I would like to regulate the expression of a gene and in order to do that, I have purchased specific siRNA. After optimizing my transfection protocol and using electroporation I have achieved a 60-70% reduction of the gene of interest. However, I cannot observe a significant reduction of mRNA expression but only a reduction of protein. What might be the problem? Could the problem be in my cell treatment method?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / RNAi /miRNA transfection Human Cells - THP-1 Lipofectamine using Lipofectamine® RNAiMAX Transfection Reagent from Thermo Fisher Scientific.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for Lipofectamine® RNAiMAX Transfection Reagent below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / RNAi /miRNA transfection Human Cells - THP-1 Lipofectamine using Lipofectamine® RNAiMAX Transfection Reagent from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms