hCas9

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Protocol tips
There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Publication protocol

The human codon-optimized Cas9 expression vector was obtained from Addgene (plasmid 41815) (26), and Cas9 was cloned into a pEF6 expression vector downstream and in-frame with a nuclearly localized YFP linked by a viral 2A bicistronic peptide (27) so that nls-YFP and Cas9 were expressed in approximate equimolar quantities. A guide RNA, including the U6 promoter, was synthesized as a 500-bp gBlocks fragment (Integrated DNA Technologies) and was cloned into the pEF6-nls-YFP-2A-Cas9 vector by InFusion Cloning (Clontech). The single-guide RNA (sgRNA) sequences were designed to target trans-membrane regions of the ATP7A gene and determined by the CRISPR Design Tool. Two synthesized single-guide RNA oligos (Integrated DNA Technology) for each gene (ATP7A target 1, GTTTTTCTGTATCCCTGTAATGG; ATP7A target 2, CCTATGCTGTTTGTGTTTATTGC) were ligated into the Cas9 vector using the In-Fusion HD cloning kit (Clontech Laboratories). Undifferentiated 3T3-L1 cells were transfected with the resulting plasmid using Lipofectamine LTX Plus reagent (Life Technologies). Transfected cells were selected by 3 μg/ml blasticidin in cell culture medium for 2 weeks and then diluted into a 96-well plate for cell cloning. The clones were expanded into larger plates until the cell number exceeded 1 × 106, and the cryostocks were prepared. 3T3-L1-ATP7A−/− cells were identified by Western blotting analysis of cell homogenates. Briefly, cells were collected from a 10-cm dish and homogenized in 25 mm imidazole (pH 7.4), 0.25 m sucrose, 2 mm 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF), and one tablet of EDTA-free protease inhibitor mixture. The protein concentration was estimated using a BCA assay. 20 μg of homogenate was separated on 7.5% polyacrylamide gels, transferred onto a PVDF membrane, and incubated overnight at 4 °C with rabbit anti-ATP7A CT77 (Hycult Biotech) to detect ATP7A and with mouse anti-tubulin (Sigma), used as a loading control. Deletions in the ATP7A gene were identified by Sanger sequencing. Specifically, genomic DNA from positive cell clones was isolated using the GenElute mammalian genomic DNA miniprep kit (Sigma-Aldrich), and the targeted region of the ATP7A gene was amplified by PCR using the forward primer 5′-TCTTAGCCTGAGTGAGATGGTT-3′ and the reverse primer 5′-TCCACTATCTTAACAA-ATGTCACCC-3′. PCR products were cloned into the TOPO vector using the TOPO TA cloning kit (Life Technologies) and transformed into Top 10-competent cells (Life Technologies). Plasmids were then isolated using the QIAprep spin miniprep kit (Qiagen) for Sanger sequencing.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion 3T3-L1 ATP7A using hCas9 from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for hCas9 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion 3T3-L1 ATP7A using hCas9 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.