pLKO.1 puro

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Epac1 knockout in 3T3-L1 cells using clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 gene editing system.
An online design tool (http://crispr.mit.edu/) was used to identify the optimal single guide RNA (sgRNA) sequences. Two different sgRNA sequences with the highest scores were picked: Oligo 1, GTCATCTCCCTCGTGCAACGTGG, and Oligo 2, GCGGCTAGTTGGCCGATGGGTGG. These two oligonucleotides were cloned into the pLKO vector. The 3T3-L1 cells were transfected with pHAGE-EF1a-Cas9-IRES-BLAST plasmid with Lipofectamine 2000. Blasticidin was used to select cells stably expressing Cas9. Cas9-expressing 3T3-L1 cells then were transfected with Epac1-specific sgRNAs to knock out Epac1. Epac1 knockout cells were selected by puromycin and confirmed by quantitative real-time PCR (RT-qPCR) and Western blotting.

Rap1GAP transient transfection.
pFLAG-CMV2-Rap1GAP (18) or control vector was transfected into 3T3-L1 preadipocytes by electroporation according to the manufacturer's protocol established for 3T3-L1 cells using a Neon transfection system (Invitrogen). Thirty-six hours posttransfection, the cells were starved in serum-free Dulbecco's modified Eagle's medium (DMEM) for 4 h and treated with 007-AM at 10 μM or dimethyl sulfoxide (DMSO) vehicle for 25 min. After rinsing with phosphate-buffered saline (PBS), the cells were lysed in SDS sample buffer. Cell lysates with equal amounts of total proteins were load onto SDS-PAGE gels and subjected to immunoblotting analysis.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion 3T3-L1 Epac1 using pLKO.1 puro from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for pLKO.1 puro below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion 3T3-L1 Epac1 using pLKO.1 puro from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.