lentiCRISPR

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Generation of knockout lines
CRISPR-Cas9 guide RNA targeting sequences for mouse Tfeb and Tfe3 were identified bioinformatically using the CRISPR Design Tool available at https://www.genome-engineering.org.37 The targeting sequence search was limited to the first constitutively expressed exon common to all isoforms of the genes. Targeting sequences used were CACGTACTGTCCACCTCGGC for Tfeb and GAGGCGTGAGCGGCGGGAAC for Tfe3. Targeting sequences were cloned in to the lentiCRISPR plasmid (http://www.addgene.org/49535/) described in Shalem et al.38 Lentivirus was produced for the Tfeb and Tfe3 targeting sequences as well as an empty lentiCRISPR vector for control lines. Lentiviral transfer plasmids were cotransfected with VSV-G envelope (https://www.addgene.org/12259/) and packaging plasmids (https://www.addgene.org/12260/) in to HEK293T cells using Lipofectamine LTX (Invitrogen, 15338–500). Media was changed after 24 h and centrifuged and collected 72 h post-transfection.

RAW 264.7 cells at ∼30% confluency were transduced with hexadimethrine bromide (Sigma Aldrich, 107689) and viruses containing control, Tfeb, Tfe3, or both targeting sequences. Media was removed after 24 h and cells selected with 5 μg/ml puromycin (Sigma Aldrich, P8833). Individual clones were isolated by limiting dilution cloning, and knockouts of TFEB and TFE3 were confirmed via western blotting.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion RAW 264.7 Tfeb using lentiCRISPR from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for lentiCRISPR below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion RAW 264.7 Tfeb using lentiCRISPR from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.