lentiCRISPR v2

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Protocol tips
There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Publication protocol

CRISPR/Cas9 lentivirus infection.
Pairs of CRISPR guide RNA oligos (Nfatc1 single guide RNA [sgRNA] targeting TACGAGCTTCGGATCGAGGT on exon 3 and Nfatc2 sgRNA targeting GACTCGCATACCCGGATGAT on exon 2) were annealed and cloned into the BsmBI sites of lentiCRISPR V2-blasticidin and lentiCRISPR V2-puro (plasmid 52961, Addgene) vectors, respectively. CRISPR lentiviral plasmids and lentiviral packaging plasmids (pMDLg/pRRE, pRSV-Rev, and pMD2.G; Addgene) were transfected into 293T cells. Supernatants were harvested and filtered through a 0.45-μm filter 2.5 days after transfection. ATDC5 cells (gift from Mary Goldring, Hospital for Special Surgery, New York, New York, USA) were infected with CRISPR lentivirus and selected with blasticidin (Invitrogen) (5 μg/ml) and puromycin (Clontech) (4.5 μg/ml) for 5 days and 7 days, respectively.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion ATDC5 Nfatc1 using lentiCRISPR v2 from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for lentiCRISPR v2 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion ATDC5 Nfatc1 using lentiCRISPR v2 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.