lentiCRISPR v2

CRISPR Mouse - Deletion ATDC5 Nfatc1

Experiment
CRISPR Mouse - Deletion ATDC5 Nfatc1
Product
lentiCRISPR v2 from Addgene
Manufacturer
Addgene

Protocol tips

Protocol tips
There is no need to perform a negative control golden-gate reaction (without
insert) as it will always contain colonies so not a good indicator of cloning success.

Publication protocol

CRISPR/Cas9 lentivirus infection.
Pairs of CRISPR guide RNA oligos (Nfatc1 single guide RNA [sgRNA] targeting TACGAGCTTCGGATCGAGGT on exon 3 and Nfatc2 sgRNA targeting GACTCGCATACCCGGATGAT on exon 2) were annealed and cloned into the BsmBI sites of lentiCRISPR V2-blasticidin and lentiCRISPR V2-puro (plasmid 52961, Addgene) vectors, respectively. CRISPR lentiviral plasmids and lentiviral packaging plasmids (pMDLg/pRRE, pRSV-Rev, and pMD2.G; Addgene) were transfected into 293T cells. Supernatants were harvested and filtered through a 0.45-μm filter 2.5 days after transfection. ATDC5 cells (gift from Mary Goldring, Hospital for Special Surgery, New York, New York, USA) were infected with CRISPR lentivirus and selected with blasticidin (Invitrogen) (5 μg/ml) and puromycin (Clontech) (4.5 μg/ml) for 5 days and 7 days, respectively.

Full paper   Login or join for free to view the full paper.

Reviews

lentiCRISPR v2 from Addgene has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

1 year ago

Author: Mario Udinese Italy

Floxing mice with CRISPR

Hi everyone! I am planning on floxing mice with CRISPR but I am having trouble deciding which region to target. Do you have any tips on choosing?

Discussion

2 years ago

Author: Ben Saar Israel

How to choose a region to target for CRISPR

Hi everyone! I am planning on floxing mice with CRISPR but I am having trouble deciding which region to target. Do you have any tips on choosing?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion ATDC5 Nfatc1 using lentiCRISPR v2 from Addgene.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Addgene for lentiCRISPR v2 below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion ATDC5 Nfatc1 using lentiCRISPR v2 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Become shareholder Discussions About us Contact Privacy Terms