pX330-U6-Chimeric_BB-CBh-hSpCas9

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Retrovirus and Lentivirus Constructs
Vectors and detailed vector maps are available on request, and through Addgene. Methods for the production of replication defective particles based on the Murine Maloney Leukemia Virus (“retrovirus”) using the pRubi transfer vector20 or based on the Human Immunodeficiency Virus using the FUGW transfer vector (“lentivirus”)20,35, have been previously described. Lentiviral particles have broad functional tropism due to an ability to transduce both mitotic and post-mitotic/senescent cells, while retroviral particles specifically transduce dividing cells, resulting in specific infection of newborn granule neurons when injected into the dentate gyrus.

The pRubi-fluorescent protein and pRubi-fluorescent protein-T2A-Cre constructs have been previously described4.

To create pRubi-GFP- shPten, we used an annealed oligo strategy with BbsI and BglII overhangs and the TTCAAGAGA loop sequence to place Human/Mouse Pten target sequences AGGTGAAGGTATGTTCCTCCAA or AGGTGAAGATATATTCCTCCAA into pCMV-based plasmids harboring the mouse U6 or human H1 RNA Pol III promoters, respectively. The U6 promoter and Pten shRNA was cloned into the retroviral pRubi backbone to generate pRubi U6 shPten using PacI/BstBI. The H1 promoter with Pten shRNA was cloned into pRubi U6 shPten to generate pRubi U6/H1 shPten using PacI. The final construct was sequence verified and named pRubi-GFP-shPten.

Retroviruses which birthdate, label, and utilize hSpCas9 for creating genetic lesions were created in stages to sequentially introduce hSpCas9 and the guide strand cassette. First, Not1 was used to linearize PX33036 (Addgene), from which hSpCas9 was amplified and EcoR1 flanked, by PCR. The PCR product was ligated into pGEM-T Easy and sequenced verified. By EcoR1 digestion, hSpCas9 was transferred an EcoR1 site downstream of a fluorescent protein-T2A sequence in pRubi-GFP and pRubi-mCherry, generating pRubi-GFP-T2A-hSpCas9 and pRubi-mCherry-T2A-hSpCas9.

The lentiviral constructs FU- GFP-T2A-hSpCas9 and FU-mCherry-T2A-hSpCas9 were generated by sequential digestion of FUGW, pRubi-GFP-T2A-hSpCas9, and pRubi-mCherry-T2A-hSpCas9 using Xho1 and then BstB1. The GFP/mCherry-T2A-Cas9 fragments were ligated into the FU backbone and sequence verified.

We next sought to facilitate the addition of the U6, guide strand, and RNA scaffold elements from PX330 into the viral plasmid backbones. We digested PX330 with PciI, the site for which precedes the U6 promoter. Into this PciI site, we ligated annealed oligos which regenerated the PciI site, and inserted downstream of it: CCTTAATTAACCTTCGAACC, encoding Pac1 and BstB1 sites. This modified plasmid was dubbed pXL, which also retained the original Pac1 site downstream of the U6 terminator.

Into BbsI digested pXL, we ligated annealed oligos for which the sense strand encoded a Bbs1 compatible overhang, G, and a guide sequence capable of targeting mouse Pten: AACTTGTCCTCCCGCCGCGT, Katnal2 guide1: AGCAGGCACAGGTCCGTTGG, and Katnal2 guide2: ACTCACTCACCAGGCGCGGG. The entire U6, guide strand, and RNA scaffold elements were digested out of pXL using BstB1 and Pac1, and ligated into pRubi- or FU- GFP-T2A-hSpCas9 digested with the same.



Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion Neuro 2a KATNAL2 using pX330-U6-Chimeric_BB-CBh-hSpCas9 from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for pX330-U6-Chimeric_BB-CBh-hSpCas9 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion Neuro 2a KATNAL2 using pX330-U6-Chimeric_BB-CBh-hSpCas9 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.