lentiCRISPR v2

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Protocol tips
There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Publication protocol

2.5. Lentiviral Transduction for PGRMC1 Knockout
For viral transduction to knockout PGRMC1, ~ 2.5 × 104 NSC34 cells were incubated with the foregoing filtered lentivirus-containing supernatant. After 3 days of transduction, puromycin was added (final 3 μg/ml) to screen sgRNA/Cas9 positive cells. Two weeks later the cell culture was expanded to three 35-mm dishes. In order to assess the efficiency of sgRNA-guided Cas9 cutting in the PGRMC1 genomic sequence (exon-1), genomic DNA was extracted for PCR amplification of the specific region including the sgRNA/Cas9 excision site. Forward primer: gcggaggaagcggactgttc; reverse primer: agcgggccgggggcacgagg. PCR products were digested with 1 μl T7 Endonuclease I (New England Biolabs Inc., MA) for 2 h at room temperature, and then subjected to electrophoresis in a 1.5% agarose gel. PGRMC1 protein knockout was confirmed by Western blotting using a PGRMC1 specific antibody.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion NSC34 PGRMC1 using lentiCRISPR v2 from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for lentiCRISPR v2 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion NSC34 PGRMC1 using lentiCRISPR v2 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.