lentiCRISPR v2

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Protocol tips
There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Publication protocol

Clustered regularly interspaced short palindromic repeat-mediated genomic knockout
N-terminal rat MMP9 (NM) was searched for guide RNA target sites using the online software (crispr.mit.edu/guides). Pairs of oligonucleotides targeting the four highest scoring guide RNA sites along with sgBlank containing no insert were annealed and ligated into the lentiCRISPRv2 (clustered regularly interspaced short palindromic repeat) vector (Addgene #52961) after vector digestion with BsmBI following the Zhang Lab Lentiviral CRISPR Toolbox protocol (https://www.addgene.org/static/data/plasmids/52/52961/52961-attachment_B3xTwla0bkYD.pdf). Lentivirus was rescued by co-transfection of HEK293 cells with the lentiCRISPRv2 harboring the target gRNA site with the helper psPAX2 and pVSVG plasmids (Addgene #12260 and #12259). Three days post-transfection, the medium containing the lentivirus was harvested, passed through a 45-µm filter, and added directly to the PC12 cell culture medium. Four days post-infection, selection with puromycin (2 µg/ml) was initiated. Cell colonies were picked after islands of surviving cells became visible and further expanded in the puromycin medium. Of the four gRNA target sites explored, ccagcgccagccgacttatg targeting nucleotides 66–85 (top strand) of rat MMP9 cDNA (NM031055) resulted in the PC12 knockout cell line.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Rat - Deletion PC12 MMP9 using lentiCRISPR v2 from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for lentiCRISPR v2 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Rat - Deletion PC12 MMP9 using lentiCRISPR v2 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.